Theragen Bio

Research Data

Environmental and anthropogenic factors synergistically affect space use of jaguars

Posted on by Alison
Environmental and anthropogenic factors synergistically affect space use of jaguars
Large terrestrial carnivores have undergone some of the most important inhabitants declines and vary reductions of any species, which is of concern as they’ll have massive results on ecosystem dynamics and operate.1-4 The jaguar (Panthera onca) is the apex predator all through the bulk of the Neotropics; nonetheless, its distribution has been diminished by >50% and it survives in more and more remoted populations.
Consequently, the range-wide administration of the jaguar relies upon upon sustaining core populations related by way of multi-national, transboundary cooperation, which requires understanding the motion ecology and space use of jaguars all through their vary.6-8 Using GPS telemetry information for 111 jaguars from 13 ecoregions throughout the 4 biomes that represent the bulk of jaguar habitat, we examined the landscape-level environmental and anthropogenic factors associated to jaguar dwelling vary dimension and motion parameters.
Home vary dimension decreased with growing web productiveness and forest cowl and elevated with growing street density. Speed decreased with growing forest cowl with no sexual variations, whereas males had extra directional actions, however tortuosity in actions was not associated to any panorama factors. We demonstrated a synergistic relationship between landscape-scale environmental and anthropogenic factors and jaguars’ spatial wants, which has purposes to the conservation technique for the species all through the Neotropics.
Using large-scale collaboration, we overcame limitations from small pattern sizes typical in massive carnivore analysis to offer a mechanism to judge habitat high quality for jaguars and an inferential modeling framework adaptable to the conservation of different massive terrestrial carnivores.

Proteomic Analysis of Histone Crotonylation Suggests Diverse Functions in Myzus persicae

Myzus persicae is one of crucial financial pests of cultivated crops. In the current examine, we used an built-in method involving high-performance liquid chromatography fractionation, affinity enrichment, and mass spectrometry-based proteomics to hold out a complete proteomic evaluation of lysine crotonylation in M. persicae. Altogether, 7530 lysine crotonylation websites have been recognized in 2452 protein teams.
Intensive bioinformatic analyses have been then carried out to annotate these lysine crotonylated targets recognized in phrases of Gene Ontology annotation, area annotation, subcellular localization, Kyoto Encyclopedia of Genes and Genomes pathway annotation, practical cluster evaluation, and so forth. Analysis outcomes confirmed that lysine-crotonylated proteins have been concerned in lots of organic processes, such because the amino acid metabolism, aminoacyl-tRNA biosynthesis, spliceosomes, ribosomes, and so forth.
Notably, the interplay community confirmed that there have been 199 crotonylated proteins concerned within the amino acid metabolism and quite a few crotonylation targets related to fatty acid biosynthesis and degradation. The outcomes present a system-wide view of all the M. persicae crotonylome and a wealthy information set for practical evaluation of crotonylated proteins on this economically vital pest, which marks an vital starting for the additional analysis.
Environmental and anthropogenic factors synergistically affect space use of jaguars

Advancing Undergraduate Synthetic Biology Education: Insights from a Canadian iGEM Student Perspective

The final twenty years have seen vigorous exercise in artificial biology analysis and ever-increasing purposes of its applied sciences. However, pedagogical analysis pertaining to instructing artificial biology is scarce, particularly when in comparison with different science and engineering disciplines. Within Canada there are solely three universities that provide artificial biology applications; two of that are on the undergraduate stage.
Rather than happen in formal tutorial settings, many Canadian undergraduate college students are launched to artificial biology by way of participation within the annual International Genetically Engineered Machine (iGEM) competitors. Although the iGEM competitors has had a transformative affect on artificial biology coaching in different nations, the affect in Canada has been comparatively modest.
Consequently, the iGEM competitors remains to be a significant setting for artificial biology schooling in Canada. To promote additional improvement of artificial biology schooling, we surveyed undergraduate college students from the Canadian iGEM design groups of 2019. We extracted insights from these information utilizing qualitative evaluation to offer suggestions for greatest instructing practices in artificial biology undergraduate schooling, which we describe by way of our proposed Framework for Transdisciplinary Synthetic Biology Education (FTSBE).

Curated Data In – Trustworthy In Silico Models Out: The Impact of Data Quality on the Reliability of Artificial Intelligence Models as Alternatives to Animal Testing

New Approach Methodologies (NAMs) that make use of synthetic intelligence (AI) for predicting adversarial results of chemical compounds have generated optimistic expectations as options to animal testing. However, the foremost underappreciated problem in growing strong and predictive AI fashions is the affect of the standard of the enter information on the mannequin accuracy. Indeed, poor information reproducibility and high quality have been incessantly cited as factors contributing to the disaster in biomedical analysis, in addition to comparable shortcomings within the fields of toxicology and chemistry.
In this text, we overview the newest efforts to enhance confidence within the robustness of toxicological information and examine the affect that information curation has on the arrogance in mannequin predictions. We additionally current two case research demonstrating the impact of information curation on the efficiency of AI fashions for predicting pores and skin sensitisation and pores and skin irritation.

ASAH2 Rabbit pAb
A12596-200ul 200 ul
EUR 459

ASAH2 Rabbit pAb
A12596-20ul 20 ul
EUR 183

ASAH2 Rabbit pAb
A12596-50ul 50 ul
EUR 223

ASAH2 Rabbit pAb
A7985-100ul 100 ul
EUR 308

ASAH2 Rabbit pAb
A7985-200ul 200 ul
EUR 459

ASAH2 Rabbit pAb
A7985-20ul 20 ul
EUR 183

ASAH2 Rabbit pAb
A7985-50ul 50 ul
EUR 223

ASAH2 Antibody
36240-100ul 100ul
EUR 252

ASAH2 Antibody
3828-100
EUR 316

ASAH2 Antibody
3828-30T
EUR 146

ASAH2 Antibody
24731-100ul 100ul
EUR 390

ASAH2 antibody
70R-12124 100 ug
EUR 403
Description: Rabbit polyclonal ASAH2 antibody

ASAH2 Antibody
1-CSB-PA002170EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

ASAH2 Antibody
1-CSB-PA133826
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ASAH2 Antibody
1-CSB-PA076840
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ASAH2 Polyclonal Antibody, HRP Conjugated
A62107 100 µg
EUR 570.55
Description: reagents widely cited

ASAH2 Polyclonal Antibody, FITC Conjugated
A62108 100 µg
EUR 570.55
Description: Ask the seller for details

ASAH2 Polyclonal Antibody, Biotin Conjugated
A62109 100 µg
EUR 570.55
Description: The best epigenetics products

ASAH2 Conjugated Antibody
C36240 100ul
EUR 397

Anti-ASAH2 antibody
STJ110292 100 µl
EUR 277

Anti-ASAH2 antibody
STJ114470 100 µl
EUR 277

ASAH2 siRNA
20-abx900469
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAH2 siRNA
20-abx908269
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAH2 siRNA
20-abx908270
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAH2 Antibody, HRP conjugated
1-CSB-PA002170EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ASAH2 Antibody, FITC conjugated
1-CSB-PA002170EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ASAH2 Antibody, Biotin conjugated
1-CSB-PA002170ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ASAH2 Blocking Peptide
33R-10941 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASAH2 antibody, catalog no. 70R-12124

ASAH2 Blocking Peptide
3828BP-50
EUR 153

ASAH2 cloning plasmid
CSB-CL865115HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2181
  • Sequence: ATGAGTGCCATCACAGTGGCCCTTCTCAGCCTCTTGTTTATCACCAGTGGGACCATTGAAAACCACAAAGATTTAGGAGGCCATTTTTTTTCAACCACCCAAAGCCCTCCAGCCACCCAGGGCTCCACAGCCGCCCAACGCTCCACAGCCACCCAGCATTCCACAGCCACCCAGA
  • Show more
Description: A cloning plasmid for the ASAH2 gene.

Mouse ASAH2 shRNA Plasmid
20-abx974501
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ASAH2 shRNA Plasmid
20-abx987160
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ASAH2 shRNA Plasmid
20-abx961153
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ASAH2 Recombinant Protein (Human)
RP036760 100 ug Ask for price

ASAH2 Recombinant Protein (Rat)
RP191108 100 ug Ask for price

ASAH2 Recombinant Protein (Mouse)
RP117410 100 ug Ask for price

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx007107
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
abx025039-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
abx025039-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx173712
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx177710
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx214010
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx214011
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx303129
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (HRP)
20-abx303130
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (FITC)
20-abx303131
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (Biotin)
20-abx303132
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Asah2 ORF Vector (Mouse) (pORF)
ORF039138 1.0 ug DNA
EUR 506

ASAH2 ORF Vector (Human) (pORF)
ORF012254 1.0 ug DNA
EUR 354

Asah2 ORF Vector (Rat) (pORF)
ORF063704 1.0 ug DNA
EUR 506

ASAH2 ELISA Kit (Human) (OKCD01831)
OKCD01831 96 Wells
EUR 831
Description: Description of target: Hydrolyzes the sphingolipid ceramide into sphingosine and free fatty acid at an optimal pH of 6.5-8.5. Acts as a key regulator of sphingolipid signaling metabolites by generating sphingosine at the cell surface. Acts as a repressor of apoptosis both by reducing C16-ceramide, thereby preventing ceramide-induced apoptosis, and generating sphingosine, a precursor of the antiapoptotic factor sphingosine 1-phosphate. Probably involved in the digestion of dietary sphingolipids in intestine by acting as a key enzyme for the catabolism of dietary sphingolipids and regulating the levels of bioactive sphingolipid metabolites in the intestinal tract.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL

ASAH2 sgRNA CRISPR Lentivector set (Human)
K0130501 3 x 1.0 ug
EUR 339

Asah2 sgRNA CRISPR Lentivector set (Mouse)
K3499601 3 x 1.0 ug
EUR 339

Asah2 sgRNA CRISPR Lentivector set (Rat)
K7087001 3 x 1.0 ug
EUR 339

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) Protein
20-abx654471
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0130502 1.0 ug DNA
EUR 154

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0130503 1.0 ug DNA
EUR 154

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0130504 1.0 ug DNA
EUR 154

Mouse ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)
ELI-34287m 96 Tests
EUR 865

Human ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)
ELI-34330h 96 Tests
EUR 824

Rat ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)
ELI-48960r 96 Tests
EUR 886

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3499602 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3499603 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3499604 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7087002 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7087003 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7087004 1.0 ug DNA
EUR 154

ASAH2 Protein Vector (Human) (pPB-C-His)
PV049013 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPB-N-His)
PV049014 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPM-C-HA)
PV049015 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPM-C-His)
PV049016 500 ng
EUR 329

ASAH2 Protein Vector (Human) (pPB-His-MBP)
PV324138 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPB-His-GST)
PV324139 500 ng
EUR 481

ASAH2 Protein Vector (Rat) (pPB-C-His)
PV254814 500 ng
EUR 1166

ASAH2 Protein Vector (Rat) (pPB-N-His)
PV254815 500 ng
EUR 1166

ASAH2 Protein Vector (Rat) (pPM-C-HA)
PV254816 500 ng
EUR 1166

ASAH2 Protein Vector (Rat) (pPM-C-His)
PV254817 500 ng
EUR 1166

ASAH2 Protein Vector (Mouse) (pPB-C-His)
PV156550 500 ng
EUR 1065

ASAH2 Protein Vector (Mouse) (pPB-N-His)
PV156551 500 ng
EUR 1065

ASAH2 Protein Vector (Mouse) (pPM-C-HA)
PV156552 500 ng
EUR 1065

ASAH2 Protein Vector (Mouse) (pPM-C-His)
PV156553 500 ng
EUR 1065

Asah2 3'UTR Luciferase Stable Cell Line
TU200951 1.0 ml Ask for price

Asah2 3'UTR GFP Stable Cell Line
TU152183 1.0 ml Ask for price

ASAH2 3'UTR Luciferase Stable Cell Line
TU001220 1.0 ml
EUR 1521

Asah2 3'UTR Luciferase Stable Cell Line
TU102183 1.0 ml Ask for price

ASAH2 3'UTR GFP Stable Cell Line
TU051220 1.0 ml
EUR 1521

Asah2 3'UTR GFP Stable Cell Line
TU250951 1.0 ml Ask for price

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
20-abx156834
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) CLIA Kit
20-abx494694
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ASAH2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV656977 1.0 ug DNA
EUR 1355

ASAH2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV656981 1.0 ug DNA
EUR 1355

ASAH2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV656982 1.0 ug DNA
EUR 1355

Human N-Acylsphingosine Amidohydrolase 2(ASAH2)ELISA Kit
QY-E04735 96T
EUR 361

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
4-SEE689Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as N-Acylsphingosine Amidohydrolase 2 elisa. Alternative names of the recognized antigen: HNAC1
  • non-lysosomal ceramidase
  • Neutral ceramidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
We present that, whereas fashions generated with uncurated information had a 7-24% greater appropriate classification fee (CCR), the perceived efficiency was, the truth is, inflated owing to the excessive quantity of duplicates within the coaching set. We assert that information curation is a important step in constructing computational fashions, to assist be certain that dependable predictions of chemical toxicity are achieved by way of use of the fashions.

Leave a Reply

Your email address will not be published. Required fields are marked *