Skip to content
Theragen Bio

Research Data

  • Home
  • Western Blot Reagents
  • Body’s bugs to be sequenced
  • Our products
  • Home
  • Western Blot Reagents
  • Body’s bugs to be sequenced
  • Our products

Human CRBN(Cereblon) ELISA Kit

  • Home
  • Human CRBN(Cereblon) ELISA Kit

Human CRBN(Cereblon) ELISA Kit

Human Cereblon (CRBN) ELISA Kit

RDR-CRBN-Hu-48Tests Reddot Biotech 48 Tests
EUR 544

Human Cereblon (CRBN) ELISA Kit

RDR-CRBN-Hu-96Tests Reddot Biotech 96 Tests
EUR 756

Human Cereblon (CRBN) ELISA Kit

RD-CRBN-Hu-48Tests Reddot Biotech 48 Tests
EUR 521

Human Cereblon (CRBN) ELISA Kit

RD-CRBN-Hu-96Tests Reddot Biotech 96 Tests
EUR 723

Mouse Cereblon (CRBN) ELISA Kit

DLR-CRBN-Mu-48T DL Develop 48T
EUR 527
  • Should the Mouse Cereblon (CRBN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cereblon (CRBN) in samples from tissue homogenates or other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit

DLR-CRBN-Mu-96T DL Develop 96T
EUR 688
  • Should the Mouse Cereblon (CRBN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cereblon (CRBN) in samples from tissue homogenates or other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit

RDR-CRBN-Mu-48Tests Reddot Biotech 48 Tests
EUR 557

Mouse Cereblon (CRBN) ELISA Kit

RDR-CRBN-Mu-96Tests Reddot Biotech 96 Tests
EUR 774

Mouse Cereblon (CRBN) ELISA Kit

RD-CRBN-Mu-48Tests Reddot Biotech 48 Tests
EUR 533

Mouse Cereblon (CRBN) ELISA Kit

RD-CRBN-Mu-96Tests Reddot Biotech 96 Tests
EUR 740

Human Cereblon (CRBN)ELISA Kit

201-12-2889 SunredBio 96 tests
EUR 440
  • This Cereblon ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cereblon (CRBN) ELISA Kit

20-abx151037 Abbexa
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Cereblon(CRBN)ELISA Kit

QY-E05053 Qayee Biotechnology 96T
EUR 400

Human Cereblon ELISA Kit (CRBN)

RK01182 Abclonal 96 Tests
EUR 521

Human Cereblon (CRBN) ELISA Kit

SEG676Hu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.

Human Cereblon (CRBN) ELISA Kit

SEG676Hu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.

Human Cereblon (CRBN) ELISA Kit

SEG676Hu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.

Human Cereblon (CRBN) ELISA Kit

SEG676Hu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.

Human Cereblon (CRBN) ELISA Kit

4-SEG676Hu Cloud-Clone
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cereblon elisa. Alternative names of the recognized antigen: MRT2A
  • Mental Retardation, Non-Syndromic, Autosomal Recessive 2A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cereblon (CRBN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Cereblon (CRBN) ELISA Kit

20-abx153810 Abbexa
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Cereblon (CRBN) ELISA Kit

SEG676Mu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit

SEG676Mu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit

SEG676Mu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit

SEG676Mu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit

4-SEG676Mu Cloud-Clone
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cereblon elisa. Alternative names of the recognized antigen: MRT2A
  • Mental Retardation, Non-Syndromic, Autosomal Recessive 2A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Cereblon (CRBN) in samples from Tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Cereblon (CRBN) Antibody

20-abx175781 Abbexa
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cereblon (CRBN) Antibody

20-abx175782 Abbexa
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cereblon (CRBN) Antibody

20-abx175783 Abbexa
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cereblon (CRBN) Antibody

20-abx111556 Abbexa
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cereblon (CRBN) Antibody

20-abx171671 Abbexa
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human CRBN/ Protein cereblon ELISA Kit

E0552Hu Sunlong 1 Kit
EUR 605

Human Protein cereblon (CRBN) ELISA Kit

abx250736-96tests Abbexa 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human CRBN(Protein cereblon) ELISA Kit

EH1457 FN Test 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q96SW2
  • Alias: CRBN/Protein cereblon/DKFZp781K0715/MGC27358/MRT2A/AD-006
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Protein cereblon, CRBN ELISA KIT

ELI-10494h Lifescience Market 96 Tests
EUR 824

ELISA kit for Human CRBN (Cereblon)

ELK4870 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cereblon (CRBN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cereblon (CRBN). N
  • Show more
Description: A sandwich ELISA kit for detection of Cereblon from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Cereblon (CRBN) CLIA Kit

20-abx495269 Abbexa
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Cereblon (CRBN) Protein

20-abx652846 Abbexa
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Protein cereblon (CRBN)

1-CSB-BP842761HU Cusabio
  • EUR 761.00
  • EUR 306.00
  • EUR 1951.00
  • EUR 1026.00
  • EUR 1422.00
  • EUR 431.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in Baculovirus

Human Protein cereblon (CRBN)

1-CSB-CF842761HU Cusabio
  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 54.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system

Human Protein cereblon (CRBN)

1-CSB-CF842761HUa6 Cusabio
  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 64.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system

Human Protein cereblon (CRBN)

1-CSB-CF842761HUc7 Cusabio
  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 51.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system

Mouse Protein cereblon, Crbn ELISA KIT

ELI-10495m Lifescience Market 96 Tests
EUR 865

Chicken Protein cereblon, CRBN ELISA KIT

ELI-25557c Lifescience Market 96 Tests
EUR 928

Cow Protein cereblon (CRBN) ELISA Kit

abx516195-96tests Abbexa 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Protein cereblon (CRBN) ELISA Kit

abx516196-96tests Abbexa 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Protein cereblon (CRBN) ELISA Kit

abx516199-96tests Abbexa 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Mouse CRBN (Cereblon)

ELK7246 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cereblon (CRBN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cereblon (CRBN). N
  • Show more
Description: A sandwich ELISA kit for detection of Cereblon from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Bovine Protein cereblon, CRBN ELISA KIT

ELI-50593b Lifescience Market 96 Tests
EUR 928

Rat Protein cereblon, Crbn ELISA KIT

ELI-47508r Lifescience Market 96 Tests
EUR 886

Mouse Cereblon (CRBN) CLIA Kit

20-abx495270 Abbexa
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Protein cereblon (Crbn)

1-CSB-YP806030MO Cusabio
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Protein cereblon(Crbn) expressed in Yeast

Protein Cereblon (CRBN) Antibody

20-abx003568 Abbexa
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Cereblon (CRBN) Antibody

abx200563-50ug Abbexa 50 ug
EUR 453
  • Shipped within 3-5 working days.

Protein Cereblon (CRBN) Antibody

20-abx322665 Abbexa
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Cereblon (CRBN) Antibody

20-abx322666 Abbexa
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse Cereblon (CRBN) Protein

20-abx652847 Abbexa
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Cereblon (CRBN) Protein

20-abx652848 Abbexa
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Protein Cereblon (CRBN) Antibody

abx231954-100ug Abbexa 100 ug
EUR 481
  • Shipped within 5-12 working days.

Crbn ELISA Kit| Rat Protein cereblon ELISA Kit

EF018463 Lifescience Market 96 Tests
EUR 689

Crbn ELISA Kit| Mouse Protein cereblon ELISA Kit

EF014465 Lifescience Market 96 Tests
EUR 689

CRBN ELISA Kit| Bovine Protein cereblon ELISA Kit

EF011221 Lifescience Market 96 Tests
EUR 689

CRBN ELISA Kit| chicken Protein cereblon ELISA Kit

EF012243 Lifescience Market 96 Tests
EUR 689

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN ImmunoStep 50 µg
EUR 349

Polyclonal CRBN / Cereblon Antibody (C-Terminus)

APR11660G Leading Biology 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN / Cereblon (C-Terminus). This antibody is tested and proven to work in the following applications:

Human CRBN ELISA Kit

ELA-E12793h Lifescience Market 96 Tests
EUR 824

CRBN ELISA KIT|Human

EF005038 Lifescience Market 96 Tests
EUR 689

CRBN ELISA Kit (Human) (OKAN05721)

OKAN05721 Aviva Systems Biology 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic cognitive disability. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

CRBN ELISA Kit (Human) (OKCD08967)

OKCD08967 Aviva Systems Biology 96 Wells
EUR 975
Description: Description of target: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutatio;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

CRBN ELISA Kit (Human) (OKEH02269)

OKEH02269 Aviva Systems Biology 96 Wells
EUR 662
Description: Description of target: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.2 ng/mL

ELISA kit for Human Protein cereblon

EK3125 SAB 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein cereblon in samples from serum, plasma, tissue homogenates and other biological fluids.

CRBN ELISA Kit (Mouse) (OKCD02462)

OKCD02462 Aviva Systems Biology 96 Wells
EUR 857
Description: Description of target: Substrate recognition component of a DCX (DDB1-CUL4-X-box) E3 protein ligase complex that mediates the ubiquitination and subsequent proteasomal degradation of target proteins, such as MEIS2. Normal degradation of key regulatory proteins is required for normal limb outgrowth and expression of the fibroblast growth factor FGF8. May play a role in memory and learning by regulating the assembly and neuronal surface expression of large-conductance calcium-activated potassium channels in brain regions involved in memory and learning via its interaction with KCNT1.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

CRBN ELISA Kit (Bovine) (OKEH07882)

OKEH07882 Aviva Systems Biology 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

CRBN ELISA Kit (Chicken) (OKEH07883)

OKEH07883 Aviva Systems Biology 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 Alpha Diagnostics 1
EUR 202

CRBN antibody

70R-16578 Fitzgerald 50 ul
EUR 435
Description: Rabbit polyclonal CRBN antibody

CRBN antibody

70R-3211 Fitzgerald 50 ug
EUR 467
Description: Rabbit polyclonal CRBN antibody raised against the N terminal of CRBN

CRBN Antibody

1-CSB-PA842761ESR1HU Cusabio
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CRBN Antibody

1-CSB-PA842761ESR2HU Cusabio
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CRBN Antibody

1-CSB-PA005944GA01HU Cusabio
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CRBN Antibody

DF12054 Affbiotech 200ul
EUR 304
Description: CRBN antibody detects endogenous levels of CRBN.

CRBN siRNA

20-abx901245 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CRBN siRNA

20-abx912756 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CRBN siRNA

20-abx912757 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CRBN

YF-PA18916 Abfrontier 50 ug
EUR 363
Description: Mouse polyclonal to CRBN

Human CRBN shRNA Plasmid

20-abx959590 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CRBN Polyclonal Antibody

30601-100ul SAB 100ul
EUR 252

CRBN Polyclonal Antibody

30601-50ul SAB 50ul
EUR 187

CRBN Blocking Peptide

33R-2125 Fitzgerald 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRBN antibody, catalog no. 70R-3211

CRBN Blocking Peptide

DF12054-BP Affbiotech 1mg
EUR 195

Polyclonal CRBN Antibody

APR11661G Leading Biology 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN . This antibody is tested and proven to work in the following applications:

CRBN cloning plasmid

CSB-CL842761HU1-10ug Cusabio 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1329
  • Sequence: atggccggcgaaggagatcagcaggacgctgcgcacaacatgggcaaccacctgccgctcctgcctgcagagagtgaggaagaagatgaaatggaagttgaagaccaggatagtaaagaagccaaaaaaccaaacatcataaattttgacaccagtctgccgacatcacatacat
  • Show more
Description: A cloning plasmid for the CRBN gene.

CRBN cloning plasmid

CSB-CL842761HU2-10ug Cusabio 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1326
  • Sequence: atggccggcgaaggagatcagcaggacgctgcgcacaacatgggcaaccacctgccgctcctgcctgagagtgaggaagaagatgaaatggaagttgaagaccaggatagtaaagaagccaaaaaaccaaacatcataaattttgacaccagtctgccgacatcacatacatacc
  • Show more
Description: A cloning plasmid for the CRBN gene.

CRBN Rabbit pAb

A4722-100ul Abclonal 100 ul
EUR 308

CRBN Rabbit pAb

A4722-200ul Abclonal 200 ul
EUR 459

CRBN Rabbit pAb

A4722-20ul Abclonal 20 ul
EUR 183

CRBN Rabbit pAb

A4722-50ul Abclonal 50 ul
EUR 223

anti- CRBN antibody

FNab01954 FN Test 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:200
  • Immunogen: cereblon
  • Uniprot ID: Q96SW2
  • Gene ID: 51185
  • Research Area: Metabolism
Description: Antibody raised against CRBN

Anti-CRBN antibody

PAab01954 Lifescience Market 100 ug
EUR 355

Anti-CRBN antibody

STJ26824 St John's Laboratory 100 µl
EUR 277
Description: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.

CRBN ORF Vector (Human) (pORF)

ORF002655 ABM 1.0 ug DNA
EUR 95

CRBN ORF Vector (Human) (pORF)

ORF002656 ABM 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT Next Advance 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT Next Advance 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit TOKU-E Kit
EUR 266

Homo-PROTAC cereblon degrader 1

HY-111594 MedChemExpress 10mg
EUR 1772

Rat CRBN shRNA Plasmid

20-abx988863 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CRBN shRNA Plasmid

20-abx975104 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CRBN Polyclonal Conjugated Antibody

C30601 SAB 100ul
EUR 397

CRBN sgRNA CRISPR Lentivector set (Human)

K0504901 ABM 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT SBI 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT SBI 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT SBI 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT SBI 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT SBI 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT SBI 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT SBI 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT SBI 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT SBI 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT SBI 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT SBI 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT SBI 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT SBI 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT SBI 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT SBI 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT SBI 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT SBI 1 Kit
EUR 153
  • Category: Cas9

Recombinant Human Protein cereblon Protein, His, Baculovirus-100ug

QP10056-ba-100ug EnQuireBio 100ug
EUR 1260

Recombinant Human Protein cereblon Protein, His, Baculovirus-20ug

QP10056-ba-20ug EnQuireBio 20ug
EUR 489

Recombinant Human Protein cereblon Protein, His, Baculovirus-50ug

QP10056-ba-50ug EnQuireBio 50ug
EUR 915

Crbn ORF Vector (Rat) (pORF)

ORF065411 ABM 1.0 ug DNA
EUR 506

Crbn ORF Vector (Mouse) (pORF)

ORF041971 ABM 1.0 ug DNA
EUR 506

Crbn ORF Vector (Mouse) (pORF)

ORF041972 ABM 1.0 ug DNA
EUR 506

CRBN sgRNA CRISPR Lentivector (Human) (Target 1)

K0504902 ABM 1.0 ug DNA
EUR 154

CRBN sgRNA CRISPR Lentivector (Human) (Target 2)

K0504903 ABM 1.0 ug DNA
EUR 154

CRBN sgRNA CRISPR Lentivector (Human) (Target 3)

K0504904 ABM 1.0 ug DNA
EUR 154

CRBN Protein Vector (Human) (pPB-C-His)

PV010617 ABM 500 ng
EUR 329

CRBN Protein Vector (Human) (pPB-N-His)

PV010618 ABM 500 ng
EUR 329

CRBN Protein Vector (Human) (pPM-C-HA)

PV010619 ABM 500 ng
EUR 329

CRBN Protein Vector (Human) (pPM-C-His)

PV010620 ABM 500 ng
EUR 329

CRBN Protein Vector (Human) (pPB-C-His)

PV010621 ABM 500 ng
EUR 329

CRBN Protein Vector (Human) (pPB-N-His)

PV010622 ABM 500 ng
EUR 329

CRBN Protein Vector (Human) (pPM-C-HA)

PV010623 ABM 500 ng
EUR 329

CRBN Protein Vector (Human) (pPM-C-His)

PV010624 ABM 500 ng
EUR 329

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT SBI 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT SBI 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT SBI 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT SBI 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT SBI 1 kit
EUR 2132
  • Category: Gene Editing

Recombinant Human Protein cereblon Protein, His, Invitro-E.coli-100ug

QP10011-iv-100ug EnQuireBio 100ug
EUR 1187

Recombinant Human Protein cereblon Protein, His, Invitro-E.coli-10ug

QP10011-iv-10ug EnQuireBio 10ug
EUR 462

Recombinant Human Protein cereblon Protein, His, Invitro-E.coli-50ug

QP10011-iv-50ug EnQuireBio 50ug
EUR 780

Polyclonal CRBN antibody - N-terminal region

APR11662G Leading Biology 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN - N-terminal region. This antibody is tested and proven to work in the following applications:

Crbn sgRNA CRISPR Lentivector set (Rat)

K6667501 ABM 3 x 1.0 ug
EUR 339

Crbn sgRNA CRISPR Lentivector set (Mouse)

K3487501 ABM 3 x 1.0 ug
EUR 339

Recombinant CRBN Protein (Met1-Leu442) [His]

VAng-Cr3790-inquire Creative Biolabs inquire Ask for price
Description: Recombinant CRBN Protein (Met1-Leu442) fused with a His tag at N-terminus was expressed in Mammalian cells, with a molecular weight of 48.62 kDa. (Uniprot ID: Q96SW2)

vWF Acty. Kit

ABP-ACT-KIT Abpcorp 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT Abpcorp 12 x 8 microwells
EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT SBI 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT SBI 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT SBI 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT SBI 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT SBI 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT SBI 10 rxn
EUR 445
  • Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 SBI 25 ul each
EUR 627
  • Category: Exosomes

Recombinant Mouse Protein cereblon Protein, His, Yeast-100ug

QP9830-ye-100ug EnQuireBio 100ug
EUR 571

Recombinant Mouse Protein cereblon Protein, His, Yeast-10ug

QP9830-ye-10ug EnQuireBio 10ug
EUR 272

Recombinant Mouse Protein cereblon Protein, His, Yeast-1mg

QP9830-ye-1mg EnQuireBio 1mg
EUR 2303

Recombinant Mouse Protein cereblon Protein, His, Yeast-200ug

QP9830-ye-200ug EnQuireBio 200ug
EUR 898

Recombinant Mouse Protein cereblon Protein, His, Yeast-500ug

QP9830-ye-500ug EnQuireBio 500ug
EUR 1505

Recombinant Mouse Protein cereblon Protein, His, Yeast-50ug

QP9830-ye-50ug EnQuireBio 50ug
EUR 354

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 SBI 5 reactions
EUR 1152
  • Category: Stem Cell Products

Crbn sgRNA CRISPR Lentivector (Rat) (Target 1)

K6667502 ABM 1.0 ug DNA
EUR 154

Crbn sgRNA CRISPR Lentivector (Rat) (Target 2)

K6667503 ABM 1.0 ug DNA
EUR 154

Crbn sgRNA CRISPR Lentivector (Rat) (Target 3)

K6667504 ABM 1.0 ug DNA
EUR 154

Crbn sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3487502 ABM 1.0 ug DNA
EUR 154

Crbn sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3487503 ABM 1.0 ug DNA
EUR 154

Crbn sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3487504 ABM 1.0 ug DNA
EUR 154

CRBN Protein Vector (Mouse) (pPB-C-His)

PV167882 ABM 500 ng
EUR 603

CRBN Protein Vector (Mouse) (pPB-N-His)

PV167883 ABM 500 ng
EUR 603

CRBN Protein Vector (Mouse) (pPM-C-HA)

PV167884 ABM 500 ng
EUR 603

CRBN Protein Vector (Mouse) (pPM-C-His)

PV167885 ABM 500 ng
EUR 603

CRBN Protein Vector (Mouse) (pPB-C-His)

PV167886 ABM 500 ng
EUR 603

CRBN Protein Vector (Mouse) (pPB-N-His)

PV167887 ABM 500 ng
EUR 603

CRBN Protein Vector (Mouse) (pPM-C-HA)

PV167888 ABM 500 ng
EUR 603

CRBN Protein Vector (Mouse) (pPM-C-His)

PV167889 ABM 500 ng
EUR 603

CRBN Protein Vector (Rat) (pPB-C-His)

PV261642 ABM 500 ng
EUR 603

CRBN Protein Vector (Rat) (pPB-N-His)

PV261643 ABM 500 ng
EUR 603

CRBN Protein Vector (Rat) (pPM-C-HA)

PV261644 ABM 500 ng
EUR 603

CRBN Protein Vector (Rat) (pPM-C-His)

PV261645 ABM 500 ng
EUR 603

Crbn 3'UTR GFP Stable Cell Line

TU154342 ABM 1.0 ml Ask for price

Crbn 3'UTR Luciferase Stable Cell Line

TU104342 ABM 1.0 ml Ask for price

Crbn 3'UTR Luciferase Stable Cell Line

TU202771 ABM 1.0 ml Ask for price

Crbn 3'UTR GFP Stable Cell Line

TU252771 ABM 1.0 ml Ask for price

CRBN 3'UTR GFP Stable Cell Line

TU054992 ABM 1.0 ml
EUR 2333

CRBN 3'UTR Luciferase Stable Cell Line

TU004992 ABM 1.0 ml
EUR 2333

CRBN sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0504905 ABM 3 x 1.0 ug
EUR 376

CRBN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV688543 ABM 1.0 ug DNA
EUR 682

CRBN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV688547 ABM 1.0 ug DNA
EUR 682

CRBN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV688548 ABM 1.0 ug DNA
EUR 682

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT SBI 1 Kit
EUR 1132
  • Category: Cas9

CRBN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0504906 ABM 1.0 ug DNA
EUR 167

CRBN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0504907 ABM 1.0 ug DNA
EUR 167

CRBN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0504908 ABM 1.0 ug DNA
EUR 167

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6667505 ABM 3 x 1.0 ug
EUR 376

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3487505 ABM 3 x 1.0 ug
EUR 376

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS

AP-STR-KIT-P CORNING 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

CRBN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV688544 ABM 1.0 ug DNA
EUR 682

CRBN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV688545 ABM 1.0 ug DNA
EUR 740

CRBN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV688546 ABM 1.0 ug DNA
EUR 740

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6667506 ABM 1.0 ug DNA
EUR 167

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6667507 ABM 1.0 ug DNA
EUR 167

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6667508 ABM 1.0 ug DNA
EUR 167

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3487506 ABM 1.0 ug DNA
EUR 167

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3487507 ABM 1.0 ug DNA
EUR 167

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3487508 ABM 1.0 ug DNA
EUR 167

Human CRBN(Cereblon) ELISA Kit

Recent Posts
  • ANTIBODY FINDER, PROTEINS AND ELISA KITS
  • QPCR Troubleshooting Guide
  • An up-to-date review on bio-resource therapeutics effective against bacterial species frequently associated with chronic sinusitis and tonsillitis
  • Bio-Fabrication: Convergence of 3D Bioprinting and Nano-Biomaterials in Tissue Engineering and Regenerative Medicine
  • Recognition of Patient Groups with Sleep Related Disorders using Bio-signal Processing and Deep Learning
Categories
  • An up-to-date review on bio-resource therapeutics effective against bacterial species frequently associated with chronic sinusitis and tonsillitis.
  • Bio-chemo-electro-mechanical modelling of the rapid movement of Mimosa pudica
  • Bio-Fabrication: Convergence of 3D Bioprinting and Nano-Biomaterials in Tissue Engineering and Regenerative Medicine
  • Exploring the additive bio-agent impacts upon ectoine production by Halomonas salina DSM5928T using corn steep liquor and soybean hydrolysate as nutrient supplement
  • Recognition of Patient Groups with Sleep Related Disorders using Bio-signal Processing and Deep Learning
  • Uncategorized

© 2019 All Right Reserved | Arowana WordPress Theme