Human CRBN(Cereblon) ELISA Kit

Human CRBN(Cereblon) ELISA Kit

Human Cereblon (CRBN) ELISA Kit

RDR-CRBN-Hu-48Tests 48 Tests
EUR 544

Human Cereblon (CRBN) ELISA Kit

RDR-CRBN-Hu-96Tests 96 Tests
EUR 756

Human Cereblon (CRBN) ELISA Kit

RD-CRBN-Hu-48Tests 48 Tests
EUR 521

Human Cereblon (CRBN) ELISA Kit

RD-CRBN-Hu-96Tests 96 Tests
EUR 723

Mouse Cereblon (CRBN) ELISA Kit

EUR 527
  • Should the Mouse Cereblon (CRBN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cereblon (CRBN) in samples from tissue homogenates or other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit

EUR 688
  • Should the Mouse Cereblon (CRBN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cereblon (CRBN) in samples from tissue homogenates or other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit

RDR-CRBN-Mu-48Tests 48 Tests
EUR 557

Mouse Cereblon (CRBN) ELISA Kit

RDR-CRBN-Mu-96Tests 96 Tests
EUR 774

Mouse Cereblon (CRBN) ELISA Kit

RD-CRBN-Mu-48Tests 48 Tests
EUR 533

Mouse Cereblon (CRBN) ELISA Kit

RD-CRBN-Mu-96Tests 96 Tests
EUR 740

Human Cereblon (CRBN)ELISA Kit

201-12-2889 96 tests
EUR 440
  • This Cereblon ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cereblon (CRBN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Cereblon(CRBN)ELISA Kit

QY-E05053 96T
EUR 400

Human Cereblon ELISA Kit (CRBN)

RK01182 96 Tests
EUR 521

Human Cereblon (CRBN) ELISA Kit

SEG676Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.

Human Cereblon (CRBN) ELISA Kit

SEG676Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.

Human Cereblon (CRBN) ELISA Kit

SEG676Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.

Human Cereblon (CRBN) ELISA Kit

SEG676Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.

Human Cereblon (CRBN) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cereblon elisa. Alternative names of the recognized antigen: MRT2A
  • Mental Retardation, Non-Syndromic, Autosomal Recessive 2A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cereblon (CRBN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Cereblon (CRBN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Cereblon (CRBN) ELISA Kit

SEG676Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit

SEG676Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit

SEG676Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit

SEG676Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cereblon elisa. Alternative names of the recognized antigen: MRT2A
  • Mental Retardation, Non-Syndromic, Autosomal Recessive 2A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Cereblon (CRBN) in samples from Tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Cereblon (CRBN) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cereblon (CRBN) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cereblon (CRBN) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cereblon (CRBN) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cereblon (CRBN) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human CRBN/ Protein cereblon ELISA Kit

E0552Hu 1 Kit
EUR 605

Human Protein cereblon (CRBN) ELISA Kit

abx250736-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human CRBN(Protein cereblon) ELISA Kit

EH1457 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q96SW2
  • Alias: CRBN/Protein cereblon/DKFZp781K0715/MGC27358/MRT2A/AD-006
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Protein cereblon, CRBN ELISA KIT

ELI-10494h 96 Tests
EUR 824

ELISA kit for Human CRBN (Cereblon)

ELK4870 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cereblon (CRBN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cereblon (CRBN). N
  • Show more
Description: A sandwich ELISA kit for detection of Cereblon from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Cereblon (CRBN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Cereblon (CRBN) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Protein cereblon (CRBN)

  • EUR 761.00
  • EUR 306.00
  • EUR 1951.00
  • EUR 1026.00
  • EUR 1422.00
  • EUR 431.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in Baculovirus

Human Protein cereblon (CRBN)

  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 54.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system

Human Protein cereblon (CRBN)

  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 64.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system

Human Protein cereblon (CRBN)

  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 51.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system

Mouse Protein cereblon, Crbn ELISA KIT

ELI-10495m 96 Tests
EUR 865

Chicken Protein cereblon, CRBN ELISA KIT

ELI-25557c 96 Tests
EUR 928

Cow Protein cereblon (CRBN) ELISA Kit

abx516195-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Protein cereblon (CRBN) ELISA Kit

abx516196-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Protein cereblon (CRBN) ELISA Kit

abx516199-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Mouse CRBN (Cereblon)

ELK7246 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cereblon (CRBN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cereblon (CRBN). N
  • Show more
Description: A sandwich ELISA kit for detection of Cereblon from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Bovine Protein cereblon, CRBN ELISA KIT

ELI-50593b 96 Tests
EUR 928

Rat Protein cereblon, Crbn ELISA KIT

ELI-47508r 96 Tests
EUR 886

Mouse Cereblon (CRBN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Protein cereblon (Crbn)

  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Protein cereblon(Crbn) expressed in Yeast

Protein Cereblon (CRBN) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Cereblon (CRBN) Antibody

abx200563-50ug 50 ug
EUR 453
  • Shipped within 3-5 working days.

Protein Cereblon (CRBN) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Cereblon (CRBN) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse Cereblon (CRBN) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Cereblon (CRBN) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Protein Cereblon (CRBN) Antibody

abx231954-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Crbn ELISA Kit| Rat Protein cereblon ELISA Kit

EF018463 96 Tests
EUR 689

Crbn ELISA Kit| Mouse Protein cereblon ELISA Kit

EF014465 96 Tests
EUR 689

CRBN ELISA Kit| Bovine Protein cereblon ELISA Kit

EF011221 96 Tests
EUR 689

CRBN ELISA Kit| chicken Protein cereblon ELISA Kit

EF012243 96 Tests
EUR 689

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Polyclonal CRBN / Cereblon Antibody (C-Terminus)

APR11660G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN / Cereblon (C-Terminus). This antibody is tested and proven to work in the following applications:


ELA-E12793h 96 Tests
EUR 824


EF005038 96 Tests
EUR 689

CRBN ELISA Kit (Human) (OKAN05721)

OKAN05721 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic cognitive disability. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

CRBN ELISA Kit (Human) (OKCD08967)

OKCD08967 96 Wells
EUR 975
Description: Description of target: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutatio;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

CRBN ELISA Kit (Human) (OKEH02269)

OKEH02269 96 Wells
EUR 662
Description: Description of target: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.2 ng/mL

ELISA kit for Human Protein cereblon

EK3125 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein cereblon in samples from serum, plasma, tissue homogenates and other biological fluids.

CRBN ELISA Kit (Mouse) (OKCD02462)

OKCD02462 96 Wells
EUR 857
Description: Description of target: Substrate recognition component of a DCX (DDB1-CUL4-X-box) E3 protein ligase complex that mediates the ubiquitination and subsequent proteasomal degradation of target proteins, such as MEIS2. Normal degradation of key regulatory proteins is required for normal limb outgrowth and expression of the fibroblast growth factor FGF8. May play a role in memory and learning by regulating the assembly and neuronal surface expression of large-conductance calcium-activated potassium channels in brain regions involved in memory and learning via its interaction with KCNT1.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

CRBN ELISA Kit (Bovine) (OKEH07882)

OKEH07882 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

CRBN ELISA Kit (Chicken) (OKEH07883)

OKEH07883 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

CRBN antibody

70R-16578 50 ul
EUR 435
Description: Rabbit polyclonal CRBN antibody

CRBN antibody

70R-3211 50 ug
EUR 467
Description: Rabbit polyclonal CRBN antibody raised against the N terminal of CRBN

CRBN Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CRBN Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CRBN Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CRBN Antibody

DF12054 200ul
EUR 304
Description: CRBN antibody detects endogenous levels of CRBN.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA18916 50 ug
EUR 363
Description: Mouse polyclonal to CRBN

Human CRBN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CRBN Polyclonal Antibody

30601-100ul 100ul
EUR 252

CRBN Polyclonal Antibody

30601-50ul 50ul
EUR 187

CRBN Blocking Peptide

33R-2125 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRBN antibody, catalog no. 70R-3211

CRBN Blocking Peptide

DF12054-BP 1mg
EUR 195

Polyclonal CRBN Antibody

APR11661G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN . This antibody is tested and proven to work in the following applications:

CRBN cloning plasmid

CSB-CL842761HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1329
  • Sequence: atggccggcgaaggagatcagcaggacgctgcgcacaacatgggcaaccacctgccgctcctgcctgcagagagtgaggaagaagatgaaatggaagttgaagaccaggatagtaaagaagccaaaaaaccaaacatcataaattttgacaccagtctgccgacatcacatacat
  • Show more
Description: A cloning plasmid for the CRBN gene.

CRBN cloning plasmid

CSB-CL842761HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1326
  • Sequence: atggccggcgaaggagatcagcaggacgctgcgcacaacatgggcaaccacctgccgctcctgcctgagagtgaggaagaagatgaaatggaagttgaagaccaggatagtaaagaagccaaaaaaccaaacatcataaattttgacaccagtctgccgacatcacatacatacc
  • Show more
Description: A cloning plasmid for the CRBN gene.

CRBN Rabbit pAb

A4722-100ul 100 ul
EUR 308

CRBN Rabbit pAb

A4722-200ul 200 ul
EUR 459

CRBN Rabbit pAb

A4722-20ul 20 ul
EUR 183

CRBN Rabbit pAb

A4722-50ul 50 ul
EUR 223

anti- CRBN antibody

FNab01954 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:200
  • Immunogen: cereblon
  • Uniprot ID: Q96SW2
  • Gene ID: 51185
  • Research Area: Metabolism
Description: Antibody raised against CRBN

Anti-CRBN antibody

PAab01954 100 ug
EUR 355

Anti-CRBN antibody

STJ26824 100 µl
EUR 277
Description: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.

CRBN ORF Vector (Human) (pORF)

ORF002655 1.0 ug DNA
EUR 95

CRBN ORF Vector (Human) (pORF)

ORF002656 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Homo-PROTAC cereblon degrader 1

HY-111594 10mg
EUR 1772

Rat CRBN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CRBN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CRBN Polyclonal Conjugated Antibody

C30601 100ul
EUR 397

CRBN sgRNA CRISPR Lentivector set (Human)

K0504901 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

Recombinant Human Protein cereblon Protein, His, Baculovirus-100ug

QP10056-ba-100ug 100ug
EUR 1260

Recombinant Human Protein cereblon Protein, His, Baculovirus-20ug

QP10056-ba-20ug 20ug
EUR 489

Recombinant Human Protein cereblon Protein, His, Baculovirus-50ug

QP10056-ba-50ug 50ug
EUR 915

Crbn ORF Vector (Rat) (pORF)

ORF065411 1.0 ug DNA
EUR 506

Crbn ORF Vector (Mouse) (pORF)

ORF041971 1.0 ug DNA
EUR 506

Crbn ORF Vector (Mouse) (pORF)

ORF041972 1.0 ug DNA
EUR 506

CRBN sgRNA CRISPR Lentivector (Human) (Target 1)

K0504902 1.0 ug DNA
EUR 154

CRBN sgRNA CRISPR Lentivector (Human) (Target 2)

K0504903 1.0 ug DNA
EUR 154

CRBN sgRNA CRISPR Lentivector (Human) (Target 3)

K0504904 1.0 ug DNA
EUR 154

CRBN Protein Vector (Human) (pPB-C-His)

PV010617 500 ng
EUR 329

CRBN Protein Vector (Human) (pPB-N-His)

PV010618 500 ng
EUR 329

CRBN Protein Vector (Human) (pPM-C-HA)

PV010619 500 ng
EUR 329

CRBN Protein Vector (Human) (pPM-C-His)

PV010620 500 ng
EUR 329

CRBN Protein Vector (Human) (pPB-C-His)

PV010621 500 ng
EUR 329

CRBN Protein Vector (Human) (pPB-N-His)

PV010622 500 ng
EUR 329

CRBN Protein Vector (Human) (pPM-C-HA)

PV010623 500 ng
EUR 329

CRBN Protein Vector (Human) (pPM-C-His)

PV010624 500 ng
EUR 329

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Recombinant Human Protein cereblon Protein, His, Invitro-E.coli-100ug

QP10011-iv-100ug 100ug
EUR 1187

Recombinant Human Protein cereblon Protein, His, Invitro-E.coli-10ug

QP10011-iv-10ug 10ug
EUR 462

Recombinant Human Protein cereblon Protein, His, Invitro-E.coli-50ug

QP10011-iv-50ug 50ug
EUR 780

Polyclonal CRBN antibody - N-terminal region

APR11662G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN - N-terminal region. This antibody is tested and proven to work in the following applications:

Crbn sgRNA CRISPR Lentivector set (Rat)

K6667501 3 x 1.0 ug
EUR 339

Crbn sgRNA CRISPR Lentivector set (Mouse)

K3487501 3 x 1.0 ug
EUR 339

Recombinant CRBN Protein (Met1-Leu442) [His]

VAng-Cr3790-inquire inquire Ask for price
Description: Recombinant CRBN Protein (Met1-Leu442) fused with a His tag at N-terminus was expressed in Mammalian cells, with a molecular weight of 48.62 kDa. (Uniprot ID: Q96SW2)

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Recombinant Mouse Protein cereblon Protein, His, Yeast-100ug

QP9830-ye-100ug 100ug
EUR 571

Recombinant Mouse Protein cereblon Protein, His, Yeast-10ug

QP9830-ye-10ug 10ug
EUR 272

Recombinant Mouse Protein cereblon Protein, His, Yeast-1mg

QP9830-ye-1mg 1mg
EUR 2303

Recombinant Mouse Protein cereblon Protein, His, Yeast-200ug

QP9830-ye-200ug 200ug
EUR 898

Recombinant Mouse Protein cereblon Protein, His, Yeast-500ug

QP9830-ye-500ug 500ug
EUR 1505

Recombinant Mouse Protein cereblon Protein, His, Yeast-50ug

QP9830-ye-50ug 50ug
EUR 354

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Crbn sgRNA CRISPR Lentivector (Rat) (Target 1)

K6667502 1.0 ug DNA
EUR 154

Crbn sgRNA CRISPR Lentivector (Rat) (Target 2)

K6667503 1.0 ug DNA
EUR 154

Crbn sgRNA CRISPR Lentivector (Rat) (Target 3)

K6667504 1.0 ug DNA
EUR 154

Crbn sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3487502 1.0 ug DNA
EUR 154

Crbn sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3487503 1.0 ug DNA
EUR 154

Crbn sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3487504 1.0 ug DNA
EUR 154

CRBN Protein Vector (Mouse) (pPB-C-His)

PV167882 500 ng
EUR 603

CRBN Protein Vector (Mouse) (pPB-N-His)

PV167883 500 ng
EUR 603

CRBN Protein Vector (Mouse) (pPM-C-HA)

PV167884 500 ng
EUR 603

CRBN Protein Vector (Mouse) (pPM-C-His)

PV167885 500 ng
EUR 603

CRBN Protein Vector (Mouse) (pPB-C-His)

PV167886 500 ng
EUR 603

CRBN Protein Vector (Mouse) (pPB-N-His)

PV167887 500 ng
EUR 603

CRBN Protein Vector (Mouse) (pPM-C-HA)

PV167888 500 ng
EUR 603

CRBN Protein Vector (Mouse) (pPM-C-His)

PV167889 500 ng
EUR 603

CRBN Protein Vector (Rat) (pPB-C-His)

PV261642 500 ng
EUR 603

CRBN Protein Vector (Rat) (pPB-N-His)

PV261643 500 ng
EUR 603

CRBN Protein Vector (Rat) (pPM-C-HA)

PV261644 500 ng
EUR 603

CRBN Protein Vector (Rat) (pPM-C-His)

PV261645 500 ng
EUR 603

Crbn 3'UTR GFP Stable Cell Line

TU154342 1.0 ml Ask for price

Crbn 3'UTR Luciferase Stable Cell Line

TU104342 1.0 ml Ask for price

Crbn 3'UTR Luciferase Stable Cell Line

TU202771 1.0 ml Ask for price

Crbn 3'UTR GFP Stable Cell Line

TU252771 1.0 ml Ask for price

CRBN 3'UTR GFP Stable Cell Line

TU054992 1.0 ml
EUR 2333

CRBN 3'UTR Luciferase Stable Cell Line

TU004992 1.0 ml
EUR 2333

CRBN sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0504905 3 x 1.0 ug
EUR 376

CRBN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV688543 1.0 ug DNA
EUR 682

CRBN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV688547 1.0 ug DNA
EUR 682

CRBN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV688548 1.0 ug DNA
EUR 682

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

CRBN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0504906 1.0 ug DNA
EUR 167

CRBN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0504907 1.0 ug DNA
EUR 167

CRBN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0504908 1.0 ug DNA
EUR 167

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6667505 3 x 1.0 ug
EUR 376

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3487505 3 x 1.0 ug
EUR 376


EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

CRBN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV688544 1.0 ug DNA
EUR 682

CRBN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV688545 1.0 ug DNA
EUR 740

CRBN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV688546 1.0 ug DNA
EUR 740

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6667506 1.0 ug DNA
EUR 167

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6667507 1.0 ug DNA
EUR 167

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6667508 1.0 ug DNA
EUR 167

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3487506 1.0 ug DNA
EUR 167

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3487507 1.0 ug DNA
EUR 167

Crbn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3487508 1.0 ug DNA
EUR 167

Human CRBN(Cereblon) ELISA Kit