Theragen Bio

Research Data

Human NPTN(Neuroplastin) ELISA Kit

Human NPTN(Neuroplastin) ELISA Kit

Human Neuroplastin (NPTN) ELISA Kit

RDR-NPTN-Hu-48Tests 48 Tests
EUR 544

Human Neuroplastin (NPTN) ELISA Kit

RDR-NPTN-Hu-96Tests 96 Tests
EUR 756

Human NPTN(Neuroplastin) ELISA Kit

EH4175 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: Q9Y639
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Neuroplastin, NPTN ELISA KIT

ELI-14849h 96 Tests
EUR 824

Human Neuroplastin (NPTN) ELISA Kit

20-abx152508
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Neuroplastin (NPTN) ELISA Kit

abx257574-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Neuroplastin (NPTN) ELISA Kit

SEC666Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit

SEC666Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit

SEC666Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit

SEC666Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit

4-SEC666Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuroplastin elisa. Alternative names of the recognized antigen: SDR1
  • GP55
  • GP65
  • SDFR1
  • np55
  • np65
  • Stromal Cell Derived Factor Receptor 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neuroplastin (NPTN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Neuroplastin(NPTN)ELISA Kit

QY-E04762 96T
EUR 361

Neuroplastin (NPTN) Antibody

abx146042-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

20-abx006050
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

abx027055-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

abx027055-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

20-abx173801
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neuroplastin (NPTN) Antibody

20-abx177788
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neuroplastin (NPTN) Antibody

20-abx321072
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

20-abx321948
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

20-abx326686
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat Neuroplastin, Nptn ELISA KIT

ELI-35323r 96 Tests
EUR 886

Mouse Neuroplastin, Nptn ELISA KIT

ELI-39707m 96 Tests
EUR 865

Mouse Neuroplastin (NPTN) ELISA Kit

abx390037-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Neuroplastin (NPTN) ELISA Kit

abx391703-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Neuroplastin (NPTN) Protein

20-abx654543
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Human NPTN (Neuroplastin)

ELK4704 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuroplastin (NPTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuroplastin (
  • Show more
Description: A sandwich ELISA kit for detection of Neuroplastin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Neuroplastin (NPTN) CLIA Kit

20-abx493824
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Nptn ELISA Kit| Rat Neuroplastin ELISA Kit

EF019063 96 Tests
EUR 689

Nptn ELISA Kit| Mouse Neuroplastin ELISA Kit

EF015676 96 Tests
EUR 689

NPTN ELISA KIT|Human

EF007364 96 Tests
EUR 689

NPTN ELISA Kit (Human) (OKCD08220)

OKCD08220 96 Wells
EUR 975
Description: Description of target: Neuroplastin is a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. The alpha and beta transcripts show differential localization within the brain.Neuroplastin is a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. The alpha and beta transcripts show differential localization within the brain.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

NPTN ELISA Kit (Human) (OKDD00432)

OKDD00432 96 Wells
EUR 975
Description: Description of target: This gene encodes a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.052 ng/mL

Neuroplastin antibody

70R-7282 50 ug
EUR 467
Description: Rabbit polyclonal Neuroplastin antibody raised against the middle region of NPTN

Neuroplastin antibody

70R-1874 100 ug
EUR 377
Description: Rabbit polyclonal Neuroplastin antibody raised against the middle region of NPTN

Neuroplastin Polyclonal Antibody

ES5530-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Neuroplastin from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Neuroplastin Polyclonal Antibody

ES5530-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Neuroplastin from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Neuroplastin Polyclonal Antibody

ABP54531-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of Neuroplastin from Human, Mouse, Rat. This Neuroplastin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160

Neuroplastin Polyclonal Antibody

ABP54531-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of Neuroplastin from Human, Mouse, Rat. This Neuroplastin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160

Neuroplastin Polyclonal Antibody

ABP54531-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of Neuroplastin from Human, Mouse, Rat. This Neuroplastin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160

Neuroplastin Blocking Peptide

33R-5985 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NPTN antibody, catalog no. 70R-1874

Neuroplastin Blocking Peptide

33R-8310 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NPTN antibody, catalog no. 70R-7282

Anti-Neuroplastin antibody

STJ94440 200 µl
EUR 197
Description: Rabbit polyclonal to Neuroplastin.

NPTN siRNA

20-abx903630
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NPTN siRNA

20-abx926287
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NPTN siRNA

20-abx926288
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NPTN antibody

10R-7067 100 ul
EUR 726
Description: Mouse monoclonal NPTN antibody

NPTN antibody

10R-7068 100 ul
EUR 691
Description: Mouse monoclonal NPTN antibody

NPTN antibody

10R-7069 100 ul
EUR 691
Description: Mouse monoclonal NPTN antibody

NPTN Antibody

1-CSB-PA008837
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

NPTN Antibody

1-CSB-PA016028ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

NPTN Antibody

1-CSB-PA016028ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human NPTN shRNA Plasmid

20-abx958925
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NPTN Recombinant Protein (Human)

RP041734 100 ug Ask for price

NPTN cloning plasmid

CSB-CL016028HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 849
  • Sequence: atgtcgggttcgtcgctgcccagcgccctggccctctcgctgttgctggtctctggctccctcctcccagggccaggcgccgctcagaacgagccaaggattgtcaccagtgaagaggtcattattcgagacagccctgttctccctgtcaccctgcagtgtaacctcacctccag
  • Show more
Description: A cloning plasmid for the NPTN gene.

NPTN Rabbit pAb

A7972-100ul 100 ul
EUR 308

Human NPTN(Neuroplastin) ELISA Kit