Theragen Bio

Research Data

Human PRM1(Protamine 1) ELISA Kit

Human PRM1(Protamine 1) ELISA Kit

Human Protamine 1 (PRM1) ELISA Kit

RD-PRM1-Hu-96Tests 96 Tests
EUR 723

Human Protamine 1 (PRM1) ELISA Kit

RDR-PRM1-Hu-48Tests 48 Tests
EUR 544

Human Protamine 1 (PRM1) ELISA Kit

RDR-PRM1-Hu-96Tests 96 Tests
EUR 756

Human Protamine 1(PRM1)ELISA Kit

GA-E1181HM-48T 48T
EUR 289

Human Protamine 1(PRM1)ELISA Kit

GA-E1181HM-96T 96T
EUR 466

Human Protamine 1 (PRM1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Protamine 1,PRM1 ELISA Kit

201-12-1165 96 tests
EUR 440
  • This Protamine 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Protamine 1, PRM1 ELISA Kit

CSB-E09630h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protamine 1, PRM1 in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protamine 1, PRM1 ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protamine 1, PRM1 in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Protamine 1(PRM1)ELISA Kit

QY-E00394 96T
EUR 361

Human Protamine 1 (PRM1) ELISA Kit

SEH308Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 1 (PRM1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 1 (PRM1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protamine 1 (PRM1) ELISA Kit

SEH308Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 1 (PRM1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 1 (PRM1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protamine 1 (PRM1) ELISA Kit

SEH308Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 1 (PRM1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 1 (PRM1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protamine 1 (PRM1) ELISA Kit

SEH308Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 1 (PRM1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 1 (PRM1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protamine 1 (PRM1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Protamine 1 elisa. Alternative names of the recognized antigen: CT94.1
  • Cancer/Testis Antigen Family 94, Member 1
  • Sperm protamine P1
  • Cysteine-rich protamine
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protamine 1 (PRM1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Protamine 1 (PRM1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protamine 1 (PRM1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Protamine 1 (PRM1)

  • EUR 449.44
  • EUR 223.00
  • EUR 1410.40
  • EUR 536.80
  • EUR 973.60
  • EUR 364.00
  • EUR 3376.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04553
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 10.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Protamine 1 expressed in: E.coli

ELISA kit for Human PRM1 (Protamine 1)

ELK4763 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protamine 1 (PRM1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Protamine 1 (PR
  • Show more
Description: A sandwich ELISA kit for detection of Protamine 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Protamine-1 (PRM1)

KTE61141-48T 48T
EUR 354
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protamine-1 (PRM1)

KTE61141-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protamine-1 (PRM1)

KTE61141-96T 96T
EUR 572
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Protamine 1 (PRM1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Protamine 1 (PRM1) Protein

  • EUR 634.00
  • EUR 272.00
  • EUR 1901.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Protamine 1 (PRM1) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRM1 (Ala2~His51)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1)

Human PRM1/ Sperm protamine P1 ELISA Kit

E2044Hu 1 Kit
EUR 571

Human PRM1(Sperm protamine P1) ELISA Kit

EH1561 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P04553
  • Alias: PRM1/Sperm protamine P1/Cysteine-rich protamine
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Sperm protamine P1, PRM1 ELISA KIT

ELI-04584h 96 Tests
EUR 824

Human Sperm protamine P1 (PRM1) ELISA Kit

abx250850-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Protamine 1 (PRM1) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRM1 (Ala2~His51)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with APC.

Protamine 1 (PRM1) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRM1 (Ala2~His51)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with Biotin.

Protamine 1 (PRM1) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRM1 (Ala2~His51)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with Cy3.

Protamine 1 (PRM1) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRM1 (Ala2~His51)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with FITC.

Protamine 1 (PRM1) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRM1 (Ala2~His51)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with HRP.

Protamine 1 (PRM1) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRM1 (Ala2~His51)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with PE.

Cow Sperm protamine P1 (PRM1) ELISA Kit

abx516736-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Sperm protamine P1 (PRM1) ELISA Kit

abx516738-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Pig Sperm protamine P1 (PRM1) ELISA Kit

abx516739-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Sperm protamine P1 (PRM1) ELISA Kit

abx516740-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Prm1/ Sperm protamine P1 ELISA Kit

E0803Ra 1 Kit
EUR 571

Mouse Sperm protamine P1, Prm1 ELISA KIT

ELI-04579m 96 Tests
EUR 865

Rat Sperm protamine P1, Prm1 ELISA KIT

ELI-04580r 96 Tests
EUR 886

Porcine Sperm protamine P1, PRM1 ELISA KIT

ELI-04581p 96 Tests
EUR 928

Rabbit Sperm protamine P1, PRM1 ELISA KIT

ELI-04582Ra 96 Tests
EUR 928

Bovine Sperm protamine P1, PRM1 ELISA KIT

ELI-04583b 96 Tests
EUR 928

Protamine 1 (PRM1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PRM1 (Ala2~His51)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with APC-Cy7.

ELISA kit for Pig Sperm protamine P1 (PRM1)

KTE80069-48T 48T
EUR 354
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Sperm protamine P1 (PRM1)

KTE80069-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Sperm protamine P1 (PRM1)

KTE80069-96T 96T
EUR 572
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Sperm protamine P1 (PRM1)

KTE90125-48T 48T
EUR 354
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Sperm protamine P1 (PRM1)

KTE90125-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Sperm protamine P1 (PRM1)

KTE90125-96T 96T
EUR 572
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Sperm protamine P1 (PRM1)

KTE100422-48T 48T
EUR 332
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Sperm protamine P1 (PRM1)

KTE100422-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Sperm protamine P1 (PRM1)

KTE100422-96T 96T
EUR 539
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Sperm protamine P1 (PRM1)

KTE10176-48T 48T
EUR 354
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Sperm protamine P1 (PRM1)

KTE10176-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Sperm protamine P1 (PRM1)

KTE10176-96T 96T
EUR 572
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Sheep Sperm protamine P1 (PRM1)

KTE110021-48T 48T
EUR 354
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Sheep Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Sheep Sperm protamine P1 (PRM1)

KTE110021-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Sheep Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Sheep Sperm protamine P1 (PRM1)

KTE110021-96T 96T
EUR 572
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Sheep Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Goat Sperm protamine P1 (PRM1)

KTE50010-48T 48T
EUR 354
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Goat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Goat Sperm protamine P1 (PRM1)

KTE50010-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Goat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Goat Sperm protamine P1 (PRM1)

KTE50010-96T 96T
EUR 572
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Goat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sperm protamine P1 (PRM1)

KTE70661-48T 48T
EUR 332
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sperm protamine P1 (PRM1)

KTE70661-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sperm protamine P1 (PRM1)

KTE70661-96T 96T
EUR 539
  • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human Protamine 1 ELISA kit

E01P0718-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protamine 1 ELISA kit

E01P0718-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protamine 1 ELISA kit

E01P0718-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protamine 1 ELISA Kit

abx051858-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human PRM1 ELISA Kit

ELA-E1407h 96 Tests
EUR 824


EF005719 96 Tests
EUR 689

Human Protamine ELISA Kit

CN-04258H1 96T
EUR 438

Human Protamine ELISA Kit

CN-04258H2 48T
EUR 289

Rat Protamine 1 ELISA kit

E02P0718-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protamine 1 ELISA kit

E02P0718-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protamine 1 ELISA kit

E02P0718-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protamine 1 ELISA kit

E03P0718-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protamine 1 ELISA kit

E03P0718-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protamine 1 ELISA kit

E03P0718-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protamine 1 ELISA kit

E04P0718-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protamine 1 ELISA kit

E04P0718-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protamine 1 ELISA kit

E04P0718-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protamine 1 ELISA kit

E06P0718-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protamine 1 ELISA kit

E06P0718-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protamine 1 ELISA kit

E06P0718-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protamine 1 ELISA kit

E07P0718-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protamine 1 ELISA kit

E07P0718-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protamine 1 ELISA kit

E07P0718-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protamine 1 ELISA kit

E08P0718-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protamine 1 ELISA kit

E08P0718-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protamine 1 ELISA kit

E08P0718-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protamine 1 ELISA kit

E09P0718-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protamine 1 ELISA kit

E09P0718-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protamine 1 ELISA kit

E09P0718-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PRM1 ELISA Kit (Human) (OKCD09042)

OKCD09042 96 Wells
EUR 975
Description: Description of target: Protamines substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis. They compact sperm DNA into a highly condensed, stable and inactive complex. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

PRM1 ELISA Kit (Human) (OKEH04849)

OKEH04849 96 Wells
EUR 740
Description: Description of target: Protamines substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis. They compact sperm DNA into a highly condensed, stable and inactive complex.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098IU/mL

Guinea pig Protamine 1 ELISA kit

E05P0718-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protamine 1 ELISA kit

E05P0718-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protamine 1 ELISA kit

E05P0718-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

anti-protamine 1

YF-PA14046 50 ug
EUR 363
Description: Mouse polyclonal to protamine 1

Human Protamine 2(PRM2) ELISA kit

E01P0867-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protamine 2(PRM2) ELISA kit

E01P0867-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protamine 2(PRM2) ELISA kit

E01P0867-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protamine- 2, PRM2 ELISA KIT

ELI-35855h 96 Tests
EUR 824

Human Protamine- 3, PRM3 ELISA KIT

ELI-45487h 96 Tests
EUR 824

Human Protamine 2 (PRM2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Protamine 2 (PRM2) ELISA Kit

DLR-PRM2-Hu-48T 48T
EUR 517
  • Should the Human Protamine 2 (PRM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protamine 2 (PRM2) in samples from tissue homogenates or other biological fluids.

Human Protamine 2 (PRM2) ELISA Kit

DLR-PRM2-Hu-96T 96T
EUR 673
  • Should the Human Protamine 2 (PRM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protamine 2 (PRM2) in samples from tissue homogenates or other biological fluids.

Human Protamine 2 (PRM2) ELISA Kit

RD-PRM2-Hu-48Tests 48 Tests
EUR 521

Human Protamine 2 (PRM2) ELISA Kit

RD-PRM2-Hu-96Tests 96 Tests
EUR 723

Human Protamine 2 (PRM2) ELISA Kit

RDR-PRM2-Hu-48Tests 48 Tests
EUR 544

Human Protamine 2 (PRM2) ELISA Kit

RDR-PRM2-Hu-96Tests 96 Tests
EUR 756

Human Protamine 3(PRM3)ELISA Kit

QY-E00392 96T
EUR 361

Human Protamine 2(PRM2)ELISA Kit

QY-E00393 96T
EUR 361

Human Protamine 2 (PRM2) ELISA Kit

SEH307Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 2 (PRM2) in Tissue homogenates and other biological fluids.

Human Protamine 2 (PRM2) ELISA Kit

SEH307Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 2 (PRM2) in Tissue homogenates and other biological fluids.

Human Protamine 2 (PRM2) ELISA Kit

SEH307Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 2 (PRM2) in Tissue homogenates and other biological fluids.

Human Protamine 2 (PRM2) ELISA Kit

SEH307Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 2 (PRM2) in Tissue homogenates and other biological fluids.

Human Protamine 2 (PRM2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Protamine 2 elisa. Alternative names of the recognized antigen: CT94.2
  • Cancer/Testis Antigen Family 94, Member 2
  • Sperm histone P2
  • Sperm protamine P2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protamine 2 (PRM2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-protamine 1 (4F10)

YF-MA14959 100 ug
EUR 363
Description: Mouse monoclonal to protamine 1

ELISA kit for Human PRM2 (Protamine 2)

ELK4739 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protamine 2 (PRM2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Protamine 2 (PR
  • Show more
Description: A sandwich ELISA kit for detection of Protamine 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Protamine-3 (PRM3)

KTE61139-48T 48T
EUR 332
  • Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protamine-3 (PRM3)

KTE61139-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protamine-3 (PRM3)

KTE61139-96T 96T
EUR 539
  • Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protamine-2 (PRM2)

KTE61140-48T 48T
EUR 332
  • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protamine-2 (PRM2)

KTE61140-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protamine-2 (PRM2)

KTE61140-96T 96T
EUR 539
  • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human PRM1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PRM1 Recombinant Protein (Human)

RP024661 100 ug Ask for price

Rat Protamine 2(PRM2) ELISA kit

E02P0867-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protamine 2(PRM2) ELISA kit

E02P0867-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protamine 2(PRM2) ELISA kit

E02P0867-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protamine 2(PRM2) ELISA kit

E03P0867-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protamine 2(PRM2) ELISA kit

E03P0867-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protamine 2(PRM2) ELISA kit

E03P0867-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protamine 2(PRM2) ELISA kit

E04P0867-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protamine 2(PRM2) ELISA kit

E04P0867-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protamine 2(PRM2) ELISA kit

E04P0867-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protamine 2(PRM2) ELISA kit

E06P0867-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protamine 2(PRM2) ELISA kit

E06P0867-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protamine 2(PRM2) ELISA kit

E06P0867-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protamine 2(PRM2) ELISA kit

E07P0867-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protamine 2(PRM2) ELISA kit

E07P0867-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protamine 2(PRM2) ELISA kit

E07P0867-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protamine 2(PRM2) ELISA kit

E08P0867-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protamine 2(PRM2) ELISA kit

E08P0867-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protamine 2(PRM2) ELISA kit

E08P0867-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protamine 2(PRM2) ELISA kit

E09P0867-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protamine 2(PRM2) ELISA kit

E09P0867-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protamine 2(PRM2) ELISA kit

E09P0867-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Protamine- 2, PRM2 ELISA KIT

ELI-15408b 96 Tests
EUR 928

Bovine Protamine- 3, PRM3 ELISA KIT

ELI-15409b 96 Tests
EUR 928

Porcine Protamine- 2, PRM2 ELISA KIT

ELI-15626p 96 Tests
EUR 928

Mouse Protamine- 2, Prm2 ELISA KIT

ELI-16781m 96 Tests
EUR 865

Mouse Protamine- 3, Prm3 ELISA KIT

ELI-45409m 96 Tests
EUR 865

Mouse Protamine 2 (PRM2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Protamine-2 (PRM2) ELISA Kit

abx391855-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Protamine 2 (PRM2) ELISA Kit

SEH307Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protamine 2 (PRM2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Protamine 2 (PRM2) ELISA Kit

SEH307Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protamine 2 (PRM2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Protamine 2 (PRM2) ELISA Kit

SEH307Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protamine 2 (PRM2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Protamine 2 (PRM2) ELISA Kit

SEH307Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protamine 2 (PRM2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Protamine 2 (PRM2) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Protamine 2 elisa. Alternative names of the recognized antigen: CT94.2
  • Cancer/Testis Antigen Family 94, Member 2
  • Sperm histone P2
  • Sperm protamine P2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Protamine 2 (PRM2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Prm2 ELISA Kit| Rat Protamine-2 ELISA Kit

EF019215 96 Tests
EUR 689

Prm2 ELISA Kit| Mouse Protamine-2 ELISA Kit

EF015958 96 Tests
EUR 689

PRM2 ELISA Kit| Bovine Protamine-2 ELISA Kit

EF011800 96 Tests
EUR 689

PRM1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1724302 1.0 ug DNA
EUR 154

Human Protamine 2 (PRM2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

PRM1 cloning plasmid

CSB-CL018728HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 156
  • Sequence: atggccaggtacagatgctgtcgcagccagagccggagcagatattaccgccagagacaaagaagtcgcagacgaaggaggcggagctgccagacacggaggagagccatgaggtgctgccgccccaggtacagaccgagatgtagaagacactaa
Description: A cloning plasmid for the PRM1 gene.

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Guinea pig Protamine 2(PRM2) ELISA kit

E05P0867-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protamine 2(PRM2) ELISA kit

E05P0867-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protamine 2(PRM2) ELISA kit

E05P0867-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse PRM2 (Protamine 2)

ELK7351 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protamine 2 (PRM2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Protamine 2 (PR
  • Show more
Description: A sandwich ELISA kit for detection of Protamine 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Pig Protamine-2 (PRM2)

KTE80180-48T 48T
EUR 354
  • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Protamine-2 (PRM2)

KTE80180-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Protamine-2 (PRM2)

KTE80180-96T 96T
EUR 572
  • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protamine-3 (PRM3)

KTE100421-48T 48T
EUR 332
  • Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protamine-3 (PRM3)

KTE100421-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protamine-3 (PRM3)

KTE100421-96T 96T
EUR 539
  • Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protamine-2 (PRM2)

KTE100867-48T 48T
EUR 332
  • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protamine-2 (PRM2)

KTE100867-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protamine-2 (PRM2)

KTE100867-96T 96T
EUR 539
  • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Protamine-2 (PRM2)

KTE10175-48T 48T
EUR 354
  • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Protamine-2 (PRM2)

KTE10175-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Protamine-2 (PRM2)

KTE10175-96T 96T
EUR 572
  • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protamine-3 (PRM3)

KTE70659-48T 48T
EUR 332
  • Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protamine-3 (PRM3)

KTE70659-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protamine-3 (PRM3)

KTE70659-96T 96T
EUR 539
  • Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protamine-2 (PRM2)

KTE70660-48T 48T
EUR 332
  • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protamine-2 (PRM2)

KTE70660-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protamine-2 (PRM2)

KTE70660-96T 96T
EUR 539
  • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PRM1 ORF Vector (Human) (pORF)

ORF008221 1.0 ug DNA
EUR 95

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Protamine 2 (PRM2) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

Human PRM1(Protamine 1) ELISA Kit