Skip to content

Research Data

Home
Western Blot Reagents
Body’s bugs to be sequenced
Our products

Home
Western Blot Reagents
Body’s bugs to be sequenced
Our products

Human PRM1(Protamine 1) ELISA Kit

Home
Human PRM1(Protamine 1) ELISA Kit

Human PRM1(Protamine 1) ELISA Kit

Human Protamine 1 (PRM1) ELISA Kit
RD-PRM1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Protamine 1 (PRM1) ELISA Kit
RDR-PRM1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Protamine 1 (PRM1) ELISA Kit
RDR-PRM1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Protamine 1(PRM1)ELISA Kit
GA-E1181HM-48T	GenAsia Biotech	48T	EUR 289

Human Protamine 1(PRM1)ELISA Kit
GA-E1181HM-96T	GenAsia Biotech	96T	EUR 466

Human Protamine 1 (PRM1) ELISA Kit
20-abx152845	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Protamine 1,PRM1 ELISA Kit
201-12-1165	SunredBio	96 tests	EUR 440
This Protamine 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Protamine 1, PRM1 ELISA Kit
CSB-E09630h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protamine 1, PRM1 in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protamine 1, PRM1 ELISA Kit
1-CSB-E09630h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protamine 1, PRM1 in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Protamine 1(PRM1)ELISA Kit
QY-E00394	Qayee Biotechnology	96T	EUR 361

Human Protamine 1 (PRM1) ELISA Kit
SEH308Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 1 (PRM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 1 (PRM1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protamine 1 (PRM1) ELISA Kit
SEH308Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 1 (PRM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 1 (PRM1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protamine 1 (PRM1) ELISA Kit
SEH308Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 1 (PRM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 1 (PRM1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protamine 1 (PRM1) ELISA Kit
SEH308Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 1 (PRM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 1 (PRM1) in Tissue homogenates, cell lysates and other biological fluids.

Human Protamine 1 (PRM1) ELISA Kit
4-SEH308Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Protamine 1 elisa. Alternative names of the recognized antigen: CT94.1 Cancer/Testis Antigen Family 94, Member 1 Sperm protamine P1 Cysteine-rich protamine
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protamine 1 (PRM1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Protamine 1 (PRM1) Antibody
20-abx128256	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Protamine 1 (PRM1) Antibody
20-abx174217	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Protamine 1 (PRM1)
4-RPH308Hu01	Cloud-Clone	EUR 449.44 EUR 223.00 EUR 1410.40 EUR 536.80 EUR 973.60 EUR 364.00 EUR 3376.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04553 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 10.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Protamine 1 expressed in: E.coli

ELISA kit for Human PRM1 (Protamine 1)
ELK4763	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protamine 1 (PRM1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Protamine 1 (PR Show more
Description: A sandwich ELISA kit for detection of Protamine 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Protamine-1 (PRM1)
KTE61141-48T	Abbkine	48T	EUR 354
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protamine-1 (PRM1)
KTE61141-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protamine-1 (PRM1)
KTE61141-96T	Abbkine	96T	EUR 572
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Protamine 1 (PRM1) CLIA Kit
20-abx495423	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Protamine 1 (PRM1) Protein
20-abx166480	Abbexa	EUR 634.00 EUR 272.00 EUR 1901.00 EUR 746.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Protamine 1 (PRM1) Polyclonal Antibody (Human)
4-PAH308Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRM1 (Ala2~His51) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1)

Human PRM1/ Sperm protamine P1 ELISA Kit
E2044Hu	Sunlong	1 Kit	EUR 571

Human PRM1(Sperm protamine P1) ELISA Kit
EH1561	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P04553 Alias: PRM1/Sperm protamine P1/Cysteine-rich protamine
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Sperm protamine P1, PRM1 ELISA KIT
ELI-04584h	Lifescience Market	96 Tests	EUR 824

Human Sperm protamine P1 (PRM1) ELISA Kit
abx250850-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Protamine 1 (PRM1) Polyclonal Antibody (Human), APC
4-PAH308Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRM1 (Ala2~His51) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with APC.

Protamine 1 (PRM1) Polyclonal Antibody (Human), Biotinylated
4-PAH308Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRM1 (Ala2~His51) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with Biotin.

Protamine 1 (PRM1) Polyclonal Antibody (Human), Cy3
4-PAH308Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRM1 (Ala2~His51) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with Cy3.

Protamine 1 (PRM1) Polyclonal Antibody (Human), FITC
4-PAH308Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRM1 (Ala2~His51) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with FITC.

Protamine 1 (PRM1) Polyclonal Antibody (Human), HRP
4-PAH308Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRM1 (Ala2~His51) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with HRP.

Protamine 1 (PRM1) Polyclonal Antibody (Human), PE
4-PAH308Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRM1 (Ala2~His51) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with PE.

Cow Sperm protamine P1 (PRM1) ELISA Kit
abx516736-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Sperm protamine P1 (PRM1) ELISA Kit
abx516738-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Pig Sperm protamine P1 (PRM1) ELISA Kit
abx516739-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Sperm protamine P1 (PRM1) ELISA Kit
abx516740-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Prm1/ Sperm protamine P1 ELISA Kit
E0803Ra	Sunlong	1 Kit	EUR 571

Mouse Sperm protamine P1, Prm1 ELISA KIT
ELI-04579m	Lifescience Market	96 Tests	EUR 865

Rat Sperm protamine P1, Prm1 ELISA KIT
ELI-04580r	Lifescience Market	96 Tests	EUR 886

Porcine Sperm protamine P1, PRM1 ELISA KIT
ELI-04581p	Lifescience Market	96 Tests	EUR 928

Rabbit Sperm protamine P1, PRM1 ELISA KIT
ELI-04582Ra	Lifescience Market	96 Tests	EUR 928

Bovine Sperm protamine P1, PRM1 ELISA KIT
ELI-04583b	Lifescience Market	96 Tests	EUR 928

Protamine 1 (PRM1) Polyclonal Antibody (Human), APC-Cy7
4-PAH308Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PRM1 (Ala2~His51) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with APC-Cy7.

ELISA kit for Pig Sperm protamine P1 (PRM1)
KTE80069-48T	Abbkine	48T	EUR 354
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Pig Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Sperm protamine P1 (PRM1)
KTE80069-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Pig Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Sperm protamine P1 (PRM1)
KTE80069-96T	Abbkine	96T	EUR 572
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Pig Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Sperm protamine P1 (PRM1)
KTE90125-48T	Abbkine	48T	EUR 354
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Sperm protamine P1 (PRM1)
KTE90125-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Sperm protamine P1 (PRM1)
KTE90125-96T	Abbkine	96T	EUR 572
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Sperm protamine P1 (PRM1)
KTE100422-48T	Abbkine	48T	EUR 332
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Rat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Sperm protamine P1 (PRM1)
KTE100422-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Rat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Sperm protamine P1 (PRM1)
KTE100422-96T	Abbkine	96T	EUR 539
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Rat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Sperm protamine P1 (PRM1)
KTE10176-48T	Abbkine	48T	EUR 354
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Bovine Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Sperm protamine P1 (PRM1)
KTE10176-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Bovine Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Sperm protamine P1 (PRM1)
KTE10176-96T	Abbkine	96T	EUR 572
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Bovine Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Sheep Sperm protamine P1 (PRM1)
KTE110021-48T	Abbkine	48T	EUR 354
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Sheep Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Sheep Sperm protamine P1 (PRM1)
KTE110021-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Sheep Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Sheep Sperm protamine P1 (PRM1)
KTE110021-96T	Abbkine	96T	EUR 572
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Sheep Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Goat Sperm protamine P1 (PRM1)
KTE50010-48T	Abbkine	48T	EUR 354
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Goat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Goat Sperm protamine P1 (PRM1)
KTE50010-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Goat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Goat Sperm protamine P1 (PRM1)
KTE50010-96T	Abbkine	96T	EUR 572
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Goat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sperm protamine P1 (PRM1)
KTE70661-48T	Abbkine	48T	EUR 332
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sperm protamine P1 (PRM1)
KTE70661-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sperm protamine P1 (PRM1)
KTE70661-96T	Abbkine	96T	EUR 539
Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Protamine 1 ELISA kit
E01P0718-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protamine 1 ELISA kit
E01P0718-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protamine 1 ELISA kit
E01P0718-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protamine 1 ELISA Kit
abx051858-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human PRM1 ELISA Kit
ELA-E1407h	Lifescience Market	96 Tests	EUR 824

PRM1 ELISA KIT\|Human
EF005719	Lifescience Market	96 Tests	EUR 689

Human Protamine ELISA Kit
CN-04258H1	ChemNorm	96T	EUR 438

Human Protamine ELISA Kit
CN-04258H2	ChemNorm	48T	EUR 289

Rat Protamine 1 ELISA kit
E02P0718-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protamine 1 ELISA kit
E02P0718-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protamine 1 ELISA kit
E02P0718-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protamine 1 ELISA kit
E03P0718-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protamine 1 ELISA kit
E03P0718-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protamine 1 ELISA kit
E03P0718-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protamine 1 ELISA kit
E04P0718-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protamine 1 ELISA kit
E04P0718-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protamine 1 ELISA kit
E04P0718-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protamine 1 ELISA kit
E06P0718-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protamine 1 ELISA kit
E06P0718-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protamine 1 ELISA kit
E06P0718-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protamine 1 ELISA kit
E07P0718-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protamine 1 ELISA kit
E07P0718-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protamine 1 ELISA kit
E07P0718-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protamine 1 ELISA kit
E08P0718-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protamine 1 ELISA kit
E08P0718-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protamine 1 ELISA kit
E08P0718-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protamine 1 ELISA kit
E09P0718-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protamine 1 ELISA kit
E09P0718-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protamine 1 ELISA kit
E09P0718-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PRM1 ELISA Kit (Human) (OKCD09042)
OKCD09042	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Protamines substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis. They compact sperm DNA into a highly condensed, stable and inactive complex. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

PRM1 ELISA Kit (Human) (OKEH04849)
OKEH04849	Aviva Systems Biology	96 Wells	EUR 740
Description: Description of target: Protamines substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis. They compact sperm DNA into a highly condensed, stable and inactive complex.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098IU/mL

Guinea pig Protamine 1 ELISA kit
E05P0718-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protamine 1 ELISA kit
E05P0718-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protamine 1 ELISA kit
E05P0718-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

anti-protamine 1
YF-PA14046	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to protamine 1

Human Protamine 2(PRM2) ELISA kit
E01P0867-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protamine 2(PRM2) ELISA kit
E01P0867-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protamine 2(PRM2) ELISA kit
E01P0867-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protamine- 2, PRM2 ELISA KIT
ELI-35855h	Lifescience Market	96 Tests	EUR 824

Human Protamine- 3, PRM3 ELISA KIT
ELI-45487h	Lifescience Market	96 Tests	EUR 824

Human Protamine 2 (PRM2) ELISA Kit
20-abx152846	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Protamine 2 (PRM2) ELISA Kit
DLR-PRM2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Protamine 2 (PRM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protamine 2 (PRM2) in samples from tissue homogenates or other biological fluids.

Human Protamine 2 (PRM2) ELISA Kit
DLR-PRM2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Protamine 2 (PRM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protamine 2 (PRM2) in samples from tissue homogenates or other biological fluids.

Human Protamine 2 (PRM2) ELISA Kit
RD-PRM2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Protamine 2 (PRM2) ELISA Kit
RD-PRM2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Protamine 2 (PRM2) ELISA Kit
RDR-PRM2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Protamine 2 (PRM2) ELISA Kit
RDR-PRM2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Protamine 3(PRM3)ELISA Kit
QY-E00392	Qayee Biotechnology	96T	EUR 361

Human Protamine 2(PRM2)ELISA Kit
QY-E00393	Qayee Biotechnology	96T	EUR 361

Human Protamine 2 (PRM2) ELISA Kit
SEH307Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 2 (PRM2) in Tissue homogenates and other biological fluids.

Human Protamine 2 (PRM2) ELISA Kit
SEH307Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 2 (PRM2) in Tissue homogenates and other biological fluids.

Human Protamine 2 (PRM2) ELISA Kit
SEH307Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 2 (PRM2) in Tissue homogenates and other biological fluids.

Human Protamine 2 (PRM2) ELISA Kit
SEH307Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 2 (PRM2) in Tissue homogenates and other biological fluids.

Human Protamine 2 (PRM2) ELISA Kit
4-SEH307Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Protamine 2 elisa. Alternative names of the recognized antigen: CT94.2 Cancer/Testis Antigen Family 94, Member 2 Sperm histone P2 Sperm protamine P2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protamine 2 (PRM2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

PRM1 siRNA
20-abx904250	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PRM1 siRNA
20-abx929838	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PRM1 siRNA
20-abx929839	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Anti-protamine 1 (4F10)
YF-MA14959	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to protamine 1

ELISA kit for Human PRM2 (Protamine 2)
ELK4739	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protamine 2 (PRM2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Protamine 2 (PR Show more
Description: A sandwich ELISA kit for detection of Protamine 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Protamine-3 (PRM3)
KTE61139-48T	Abbkine	48T	EUR 332
Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protamine-3 (PRM3)
KTE61139-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protamine-3 (PRM3)
KTE61139-96T	Abbkine	96T	EUR 539
Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protamine-2 (PRM2)
KTE61140-48T	Abbkine	48T	EUR 332
Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protamine-2 (PRM2)
KTE61140-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protamine-2 (PRM2)
KTE61140-96T	Abbkine	96T	EUR 539
Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o Show more
Description: Quantitative sandwich ELISA for measuring Human Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human PRM1 shRNA Plasmid
20-abx953786	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PRM1 Recombinant Protein (Human)
RP024661	ABM	100 ug	Ask for price

Rat Protamine 2(PRM2) ELISA kit
E02P0867-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protamine 2(PRM2) ELISA kit
E02P0867-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protamine 2(PRM2) ELISA kit
E02P0867-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protamine 2(PRM2) ELISA kit
E03P0867-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protamine 2(PRM2) ELISA kit
E03P0867-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protamine 2(PRM2) ELISA kit
E03P0867-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protamine 2(PRM2) ELISA kit
E04P0867-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protamine 2(PRM2) ELISA kit
E04P0867-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protamine 2(PRM2) ELISA kit
E04P0867-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protamine 2(PRM2) ELISA kit
E06P0867-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protamine 2(PRM2) ELISA kit
E06P0867-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protamine 2(PRM2) ELISA kit
E06P0867-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protamine 2(PRM2) ELISA kit
E07P0867-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protamine 2(PRM2) ELISA kit
E07P0867-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protamine 2(PRM2) ELISA kit
E07P0867-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protamine 2(PRM2) ELISA kit
E08P0867-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protamine 2(PRM2) ELISA kit
E08P0867-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protamine 2(PRM2) ELISA kit
E08P0867-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protamine 2(PRM2) ELISA kit
E09P0867-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protamine 2(PRM2) ELISA kit
E09P0867-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protamine 2(PRM2) ELISA kit
E09P0867-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Protamine- 2, PRM2 ELISA KIT
ELI-15408b	Lifescience Market	96 Tests	EUR 928

Bovine Protamine- 3, PRM3 ELISA KIT
ELI-15409b	Lifescience Market	96 Tests	EUR 928

Porcine Protamine- 2, PRM2 ELISA KIT
ELI-15626p	Lifescience Market	96 Tests	EUR 928

Mouse Protamine- 2, Prm2 ELISA KIT
ELI-16781m	Lifescience Market	96 Tests	EUR 865

Mouse Protamine- 3, Prm3 ELISA KIT
ELI-45409m	Lifescience Market	96 Tests	EUR 865

Mouse Protamine 2 (PRM2) ELISA Kit
20-abx156983	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Protamine-2 (PRM2) ELISA Kit
abx391855-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Protamine 2 (PRM2) ELISA Kit
SEH307Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protamine 2 (PRM2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Protamine 2 (PRM2) ELISA Kit
SEH307Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protamine 2 (PRM2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Protamine 2 (PRM2) ELISA Kit
SEH307Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protamine 2 (PRM2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Protamine 2 (PRM2) ELISA Kit
SEH307Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protamine 2 (PRM2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Protamine 2 (PRM2) ELISA Kit
4-SEH307Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Protamine 2 elisa. Alternative names of the recognized antigen: CT94.2 Cancer/Testis Antigen Family 94, Member 2 Sperm histone P2 Sperm protamine P2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Protamine 2 (PRM2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Prm2 ELISA Kit\| Rat Protamine-2 ELISA Kit
EF019215	Lifescience Market	96 Tests	EUR 689

Prm2 ELISA Kit\| Mouse Protamine-2 ELISA Kit
EF015958	Lifescience Market	96 Tests	EUR 689

PRM2 ELISA Kit\| Bovine Protamine-2 ELISA Kit
EF011800	Lifescience Market	96 Tests	EUR 689

PRM1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1724302	ABM	1.0 ug DNA	EUR 154

Human Protamine 2 (PRM2) CLIA Kit
20-abx495421	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

PRM1 cloning plasmid
CSB-CL018728HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 156 Sequence: atggccaggtacagatgctgtcgcagccagagccggagcagatattaccgccagagacaaagaagtcgcagacgaaggaggcggagctgccagacacggaggagagccatgaggtgctgccgccccaggtacagaccgagatgtagaagacactaa
Description: A cloning plasmid for the PRM1 gene.

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Guinea pig Protamine 2(PRM2) ELISA kit
E05P0867-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protamine 2(PRM2) ELISA kit
E05P0867-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protamine 2(PRM2) ELISA kit
E05P0867-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse PRM2 (Protamine 2)
ELK7351	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protamine 2 (PRM2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Protamine 2 (PR Show more
Description: A sandwich ELISA kit for detection of Protamine 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Pig Protamine-2 (PRM2)
KTE80180-48T	Abbkine	48T	EUR 354
Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o Show more
Description: Quantitative sandwich ELISA for measuring Pig Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Protamine-2 (PRM2)
KTE80180-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o Show more
Description: Quantitative sandwich ELISA for measuring Pig Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Protamine-2 (PRM2)
KTE80180-96T	Abbkine	96T	EUR 572
Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o Show more
Description: Quantitative sandwich ELISA for measuring Pig Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protamine-3 (PRM3)
KTE100421-48T	Abbkine	48T	EUR 332
Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do Show more
Description: Quantitative sandwich ELISA for measuring Rat Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protamine-3 (PRM3)
KTE100421-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do Show more
Description: Quantitative sandwich ELISA for measuring Rat Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protamine-3 (PRM3)
KTE100421-96T	Abbkine	96T	EUR 539
Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do Show more
Description: Quantitative sandwich ELISA for measuring Rat Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protamine-2 (PRM2)
KTE100867-48T	Abbkine	48T	EUR 332
Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o Show more
Description: Quantitative sandwich ELISA for measuring Rat Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protamine-2 (PRM2)
KTE100867-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o Show more
Description: Quantitative sandwich ELISA for measuring Rat Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protamine-2 (PRM2)
KTE100867-96T	Abbkine	96T	EUR 539
Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o Show more
Description: Quantitative sandwich ELISA for measuring Rat Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Protamine-2 (PRM2)
KTE10175-48T	Abbkine	48T	EUR 354
Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o Show more
Description: Quantitative sandwich ELISA for measuring Bovine Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Protamine-2 (PRM2)
KTE10175-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o Show more
Description: Quantitative sandwich ELISA for measuring Bovine Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Protamine-2 (PRM2)
KTE10175-96T	Abbkine	96T	EUR 572
Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o Show more
Description: Quantitative sandwich ELISA for measuring Bovine Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protamine-3 (PRM3)
KTE70659-48T	Abbkine	48T	EUR 332
Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protamine-3 (PRM3)
KTE70659-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protamine-3 (PRM3)
KTE70659-96T	Abbkine	96T	EUR 539
Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protamine-2 (PRM2)
KTE70660-48T	Abbkine	48T	EUR 332
Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protamine-2 (PRM2)
KTE70660-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protamine-2 (PRM2)
KTE70660-96T	Abbkine	96T	EUR 539
Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PRM1 ORF Vector (Human) (pORF)
ORF008221	ABM	1.0 ug DNA	EUR 95

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Protamine 2 (PRM2) Protein
20-abx166860	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

Human PRM1(Protamine 1) ELISA Kit

Search for:

Recent Posts

ANTIBODY FINDER, PROTEINS AND ELISA KITS
QPCR Troubleshooting Guide
An up-to-date review on bio-resource therapeutics effective against bacterial species frequently associated with chronic sinusitis and tonsillitis
Bio-Fabrication: Convergence of 3D Bioprinting and Nano-Biomaterials in Tissue Engineering and Regenerative Medicine
Recognition of Patient Groups with Sleep Related Disorders using Bio-signal Processing and Deep Learning

Categories

An up-to-date review on bio-resource therapeutics effective against bacterial species frequently associated with chronic sinusitis and tonsillitis.
Bio-chemo-electro-mechanical modelling of the rapid movement of Mimosa pudica
Bio-Fabrication: Convergence of 3D Bioprinting and Nano-Biomaterials in Tissue Engineering and Regenerative Medicine
Exploring the additive bio-agent impacts upon ectoine production by Halomonas salina DSM5928T using corn steep liquor and soybean hydrolysate as nutrient supplement
Recognition of Patient Groups with Sleep Related Disorders using Bio-signal Processing and Deep Learning
Uncategorized

© 2019 All Right Reserved | Arowana WordPress Theme