Human TMPO(Thymopoietin) ELISA Kit

Human TMPO(Thymopoietin) ELISA Kit

Human Thymopoietin (TMPO) ELISA Kit
SEC824Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

Human Thymopoietin (TMPO) ELISA Kit
SEC824Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

Human Thymopoietin (TMPO) ELISA Kit
SEC824Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

Human Thymopoietin (TMPO) ELISA Kit
SEC824Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

Human Thymopoietin (TMPO) ELISA Kit
4-SEC824Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Thymopoietin elisa. Alternative names of the recognized antigen: TP LAP2 CMD1T LEMD4 TP5 Splenin Lamina-Associated Polypeptide 2, Isoforms Beta/Gamma LEM Domain Containing 4 Thymopoietin-related peptide isoforms beta/gamma
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thymopoietin (TMPO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Thymopoietin ELISA Kit (TMPO)
RK02407	Abclonal	96 Tests	EUR 521

Human Thymopoietin(TMPO)ELISA Kit
QY-E00760	Qayee Biotechnology	96T	EUR 361

Mouse Thymopoietin (TMPO) ELISA Kit
abx516010-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Thymopoietin (TMPO) ELISA Kit
abx516012-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Thymopoietin(TMPO)ELISA kit
GA-E0838MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Thymopoietin(TMPO)ELISA kit
GA-E0838MS-96T	GenAsia Biotech	96T	EUR 534

Rat Thymopoietin(TMPO)ELISA kit
QY-E10460	Qayee Biotechnology	96T	EUR 361

Mouse Thymopoietin(TMPO)ELISA kit
QY-E21460	Qayee Biotechnology	96T	EUR 361

Thymopoietin (TMPO) Antibody
20-abx116091	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
20-abx131651	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thymopoietin (TMPO) Antibody
20-abx001974	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
20-abx142268	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
abx030767-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
abx030767-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
abx028266-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
abx028266-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Thymopoietin (TMPO) Antibody
20-abx174779	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Thymopoietin (TMPO)
4-RPC824Hu01	Cloud-Clone	EUR 445.86 EUR 222.00 EUR 1396.96 EUR 532.32 EUR 964.64 EUR 361.00 EUR 3342.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P42167 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.5kDa Isoelectric Point: Inquire
Description: Recombinant Human Thymopoietin expressed in: E.coli

ELISA kit for Human TMPO (Thymopoietin)
ELK4922	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thymopoietin (TMPO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thymopoietin ( Show more
Description: A sandwich ELISA kit for detection of Thymopoietin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Thymopoietin (TMPO) CLIA Kit
20-abx493916	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Thymopoietin (TMPO) Protein
20-abx650199	Abbexa	EUR 620.00 EUR 272.00 EUR 1887.00 EUR 746.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse)
4-PAC824Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO)

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC
4-PAC824Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC824Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Biotin.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC824Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Cy3.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), FITC
4-PAC824Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with FITC.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), HRP
4-PAC824Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with HRP.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), PE
4-PAC824Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with PE.

Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAC824Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TMPO (Met1~Leu243) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC-Cy7.

Polyclonal TMPO / TP / Thymopoietin Antibody (N-Terminus)
APR03096G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMPO / TP / Thymopoietin (N-Terminus). This antibody is tested and proven to work in the following applications:

Human TMPO ELISA KIT
ELI-04132h	Lifescience Market	96 Tests	EUR 824

TMPO ELISA Kit (Human) (OKCD02937)
OKCD02937	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May help direct the assembly of the nuclear lamina and thereby help maintain the structural organization of the nuclear envelope. Possible receptor for attachment of lamin filaments to the inner nuclear membrane. May be involved in the control of initiation of DNA replication through its interaction with NAKAP95. Thymopoietin (TP) and Thymopentin (TP5) may play a role in T-cell development and function. TP5 is an immunomodulating pentapeptide. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.9 pg/mL

TMPO ELISA Kit (Human) (OKEI00289)
OKEI00289	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: May be involved in the structural organization of the nucleus and in the post-mitotic nuclear assembly. Plays an important role, together with LMNA, in the nuclear anchorage of RB1. TP and TP5 may play a role in T-cell development and function. TP5 is an immunomodulating pentapeptide. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL

TMPO / TMPO Antibody
20-abx329779	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

TMPO/TMPO Antibody
1-CSB-PA259190	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against TMPO/TMPO. Recognizes TMPO/TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

Mouse Tmpo ELISA KIT
ELI-04131m	Lifescience Market	96 Tests	EUR 865

Mouse Tmpo ELISA KIT
ELI-04134m	Lifescience Market	96 Tests	EUR 865

Thymopoietin antibody
70R-6297	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Thymopoietin antibody raised against the N terminal of TMPO

Thymopoietin antibody
70R-6298	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Thymopoietin antibody raised against the middle region of TMPO

Thymopoietin antibody
70R-6387	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Thymopoietin antibody raised against the N terminal of TMPO

Thymopoietin Antibody
25390-100ul	SAB	100ul	EUR 390

TMPO ELISA Kit (Rat) (OKEH03323)
OKEH03323	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Binds directly to lamin B1 and chromosomes in a mitotic phosphorylation-regulated manner. May play an important role in nuclear envelope reassembly at the end of mitosis and/or anchoring of the nuclear lamina and interphase chromosomes to the nuclear envelope.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.4 ng/mL

Polyclonal Thymopoietin Antibody
APR06736G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Thymopoietin . This antibody is tested and proven to work in the following applications:

Thymopoietin Blocking Peptide
33R-6275	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMPO antibody, catalog no. 70R-6297

Thymopoietin Blocking Peptide
33R-2506	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMPO antibody, catalog no. 70R-6298

Thymopoietin Blocking Peptide
33R-7041	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMPO antibody, catalog no. 70R-6387

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

TMPO siRNA
20-abx900018	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMPO siRNA
20-abx900039	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMPO siRNA
20-abx937501	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMPO siRNA
20-abx937502	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMPO siRNA
20-abx937503	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMPO antibody
70R-20884	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TMPO antibody

TMPO Antibody
ABD6994	Lifescience Market	100 ug	EUR 438

TMPO Antibody
32699-100ul	SAB	100ul	EUR 252

TMPO Antibody
DF6994	Affbiotech	200ul	EUR 304
Description: TMPO Antibody detects endogenous levels of total TMPO.

TMPO Antibody
1-CSB-PA023913GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TMPO. Recognizes TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

anti-TMPO
YF-PA27383	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TMPO

Human TMPO shRNA Plasmid
20-abx954879	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human TMPO shRNA Plasmid
20-abx954880	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TMPO Recombinant Protein (Human)
RP032329	ABM	100 ug	Ask for price

TMPO Conjugated Antibody
C32699	SAB	100ul	EUR 397

TMPO cloning plasmid
CSB-CL023913HU-10ug	Cusabio	10ug	EUR 492
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1365 Sequence: atgccggagttcctggaagacccctcggtcctgacaaaagacaagttgaagagtgagttggtcgccaacaatgtgacgctgccggccggggagcagcgcaaagacgtgtacgtccagctctacctgcagcacctcacggctcgcaaccggccgccgctccccgccggcaccaaca Show more
Description: A cloning plasmid for the TMPO gene.

TMPO Polyclonal Antibody
ES8548-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TMPO from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Human TMPO(Thymopoietin) ELISA Kit