Skip to content
Theragen Bio

Research Data

  • Home
  • Western Blot Reagents
  • Body’s bugs to be sequenced
  • Our products
  • Home
  • Western Blot Reagents
  • Body’s bugs to be sequenced
  • Our products

Human AMOT(Angiomotin) ELISA Kit

  • Home
  • Human AMOT(Angiomotin) ELISA Kit

Human AMOT(Angiomotin) ELISA Kit

Human Angiomotin (AMOT) ELISA Kit

RD-AMOT-Hu-96Tests Reddot Biotech 96 Tests
EUR 692

Human Angiomotin (AMOT) ELISA Kit

RDR-AMOT-Hu-48Tests Reddot Biotech 48 Tests
EUR 522

Human Angiomotin (AMOT) ELISA Kit

RDR-AMOT-Hu-96Tests Reddot Biotech 96 Tests
EUR 724

Human Angiomotin (AMOT) ELISA Kit

abx573197-96tests Abbexa 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human AMOT(Angiomotin) ELISA Kit

EH2205 FN Test 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: Q4VCS5
  • Alias: AMOT/KIAA1071
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Angiomotin, AMOT ELISA KIT

ELI-07348h Lifescience Market 96 Tests
EUR 824

Human Angiomotin (AMOT) ELISA Kit

20-abx150646 Abbexa
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human AMOT/ Angiomotin ELISA Kit

E0137Hu Sunlong 1 Kit
EUR 571

Human Angiomotin (AMOT) ELISA Kit

SEC296Hu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Angiomotin (AMOT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Angiomotin (AMOT) in Tissue homogenates, cell lysates and other biological fluids.

Human Angiomotin (AMOT) ELISA Kit

SEC296Hu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Angiomotin (AMOT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Angiomotin (AMOT) in Tissue homogenates, cell lysates and other biological fluids.

Human Angiomotin (AMOT) ELISA Kit

SEC296Hu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Angiomotin (AMOT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Angiomotin (AMOT) in Tissue homogenates, cell lysates and other biological fluids.

Human Angiomotin (AMOT) ELISA Kit

SEC296Hu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Angiomotin (AMOT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Angiomotin (AMOT) in Tissue homogenates, cell lysates and other biological fluids.

Human Angiomotin (AMOT) ELISA Kit

4-SEC296Hu Cloud-Clone
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Angiomotin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Angiomotin (AMOT) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Angiomotin(AMOT)ELISA Kit

QY-E00683 Qayee Biotechnology 96T
EUR 361

Mouse Angiomotin, Amot ELISA KIT

ELI-07349m Lifescience Market 96 Tests
EUR 865

Mouse Amot(Angiomotin) ELISA Kit

EM0757 FN Test 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q8VHG2
  • Alias: Amot/AMOT/KIAA1071
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml

Mouse Angiomotin (AMOT) ELISA Kit

abx255105-96tests Abbexa 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Amot/ Angiomotin ELISA Kit

E0089Mo Sunlong 1 Kit
EUR 571

Angiomotin (AMOT) Antibody

20-abx110972 Abbexa
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiomotin (AMOT) Antibody

20-abx171214 Abbexa
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Angiomotin (AMOT) Antibody

20-abx148170 Abbexa
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Angiomotin (AMOT) Antibody

20-abx006609 Abbexa
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiomotin (AMOT) Antibody

abx030454-400ul Abbexa 400 ul
EUR 523
  • Shipped within 5-10 working days.

Angiomotin (AMOT) Antibody

abx030454-80l Abbexa 80 µl
EUR 286
  • Shipped within 5-10 working days.

Angiomotin (AMOT) Antibody

20-abx175379 Abbexa
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Angiomotin (AMOT) Antibody

20-abx321581 Abbexa
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiomotin (AMOT) Antibody

20-abx225032 Abbexa
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiomotin (AMOT) Antibody

abx230366-100ug Abbexa 100 ug
EUR 481
  • Shipped within 5-12 working days.

Angiomotin (AMOT) Antibody

abx230368-100ug Abbexa 100 ug
EUR 481
  • Shipped within 5-12 working days.

ELISA kit for Human AMOT (Angiomotin)

ELK4850 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Angiomotin (AMOT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Angiomotin (AMOT
  • Show more
Description: A sandwich ELISA kit for detection of Angiomotin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Angiomotin (AMOT) CLIA Kit

20-abx493594 Abbexa
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Angiomotin (AMOT) Protein

20-abx652505 Abbexa
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human angiomotin (AMOT) control (AMOT- phosphor) peptide

AB-23097-P Alpha Diagnostics 100ug
EUR 164

Amot ELISA Kit| Mouse Angiomotin ELISA Kit

EF013368 Lifescience Market 96 Tests
EUR 689

Human angiomotin (AMOT) Control/blocking peptide

AB-23056-P Alpha Diagnostics 100ug
EUR 164

Rabbit Anti-Human angiomotin (AMOT) (AMOT- phosphor) IgG (aff pure)

AB-23097-A Alpha Diagnostics 100ug
EUR 482

Human angiomotin (AMOT) control (non-phospho) peptide

AB-23098-CP Alpha Diagnostics 100ug
EUR 164

Rabbit Anti-Human angiomotin (AMOT) IgG (aff pure)

AB-23056-A Alpha Diagnostics 100ug
EUR 482

Human AMOT ELISA Kit

ELA-E2294h Lifescience Market 96 Tests
EUR 824

AMOT ELISA KIT|Human

EF006274 Lifescience Market 96 Tests
EUR 689

Human Angiomotin ELISA kit

E01A0223-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiomotin ELISA kit

E01A0223-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AMOT ELISA Kit (Human) (OKCD08073)

OKCD08073 Aviva Systems Biology 96 Wells
EUR 936
Description: Description of target: AMOT belongs to the motin family of angiostatin binding proteins characterized by conserved coiled-coil domains and C-terminal PDZ binding motifs. The protein is expressed predominantly in endothelial cells of capillaries as well as larger vessels of the placenta where it may mediate the inhibitory effect of angiostatin on tube formation and the migration of endothelial cells toward growth factors during the formation of new blood vessels. Alternative splicing results in multiple transcript variants encoding different isoforms.This gene belongs to the motin family of angiostatin binding proteins characterized by conserved coiled-coil domains and C-terminal PDZ binding motifs. The encoded protein is expressed predominantly in endothelial cells of capillaries as well as larger vessels of the placenta where it may mediate the inhibitory effect of angiostatin on tube formation and the migration of endothelial cells toward growth factors during the formation of new blood vessels. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.119ng/mL

AMOT ELISA Kit (Human) (OKEH01627)

OKEH01627 Aviva Systems Biology 96 Wells
EUR 662
Description: Description of target: This gene belongs to the motin family of angiostatin binding proteins characterized by conserved coiled-coil domains and C-terminal PDZ binding motifs. The encoded protein is expressed predominantly in endothelial cells of capillaries as well as larger vessels of the placenta where it may mediate the inhibitory effect of angiostatin on tube formation and the migration of endothelial cells toward growth factors during the formation of new blood vessels. Alternative splicing results in multiple transcript variants encoding different isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 ng/mL

ELISA kit for Human Angiomotin

EK4484 SAB 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Angiomotin in samples from serum, plasma, tissue homogenates and other biological fluids.

Rabbit Angiomotin ELISA kit

E04A0223-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Angiomotin ELISA kit

E04A0223-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Angiomotin ELISA kit

E04A0223-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Angiomotin ELISA kit

E06A0223-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Angiomotin ELISA kit

E06A0223-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Angiomotin ELISA kit

E06A0223-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Angiomotin ELISA kit

E02A0223-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Angiomotin ELISA kit

E02A0223-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Angiomotin ELISA kit

E02A0223-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Angiomotin ELISA kit

E03A0223-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Angiomotin ELISA kit

E03A0223-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Angiomotin ELISA kit

E03A0223-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Angiomotin ELISA kit

E08A0223-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Angiomotin ELISA kit

E08A0223-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Angiomotin ELISA kit

E08A0223-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Angiomotin ELISA kit

E07A0223-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Angiomotin ELISA kit

E07A0223-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Angiomotin ELISA kit

E07A0223-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Angiomotin ELISA kit

E09A0223-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Angiomotin ELISA kit

E09A0223-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Angiomotin ELISA kit

E09A0223-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AMOT ELISA Kit (Mouse) (OKEH03500)

OKEH03500 Aviva Systems Biology 96 Wells
EUR 662
Description: Description of target: Plays a central role in tight junction maintenance via the complex formed with ARHGAP17, which acts by regulating the uptake of polarity proteins at tight junctions. Appears to regulate endothelial cell migration and tube formation. May also play a role in the assembly of endothelial cell-cell junctions.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.1 pg/mL

Guinea pig Angiomotin ELISA kit

E05A0223-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Angiomotin ELISA kit

E05A0223-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Angiomotin ELISA kit

E05A0223-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Angiomotin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse Angiomotin

EK4485 SAB 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Angiomotin in samples from serum, plasma, tissue homogenates and other biological fluids.

AMOT siRNA

20-abx907404 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AMOT siRNA

20-abx907405 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AMOT Antibody

ABD9208 Lifescience Market 100 ug
EUR 438

AMOT Antibody

45767-100ul SAB 100ul
EUR 252

AMOT Antibody

45767-50ul SAB 50ul
EUR 187

AMOT antibody

70R-15701 Fitzgerald 50 ul
EUR 435
Description: Rabbit polyclonal AMOT antibody

AMOT Antibody

DF9208 Affbiotech 200ul
EUR 304
Description: AMOT Antibody detects endogenous levels of total AMOT.

AMOT Antibody

1-CSB-PA001677ESR2HU Cusabio
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against AMOT. Recognizes AMOT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

AMOT Antibody

1-CSB-PA001677GA01HU Cusabio
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against AMOT. Recognizes AMOT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

AMOT antibody

PAab09852 Lifescience Market 100 ug
EUR 386

Human Angiomotin Like Protein 2 ELISA Kit

ELA-E2296h Lifescience Market 96 Tests
EUR 824

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 Alpha Diagnostics 1
EUR 202

anti-Angiomotin

YF-PA22510 Abfrontier 50 ul
EUR 363
Description: Mouse polyclonal to Angiomotin

anti-Angiomotin

YF-PA22511 Abfrontier 50 ug
EUR 363
Description: Mouse polyclonal to Angiomotin

anti-Angiomotin

YF-PA22512 Abfrontier 100 ug
EUR 403
Description: Rabbit polyclonal to Angiomotin

anti-Angiomotin

YF-PA26928 Abfrontier 50 ul
EUR 334
Description: Mouse polyclonal to Angiomotin

Human AMOT shRNA Plasmid

20-abx965801 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Angiomotin-like protein 2 (AMOTL2) ELISA Kit

abx520013-96tests Abbexa 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Angiomotin like protein 1(AMOTL1) ELISA kit

E01A1426-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiomotin like protein 1(AMOTL1) ELISA kit

E01A1426-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiomotin like protein 1(AMOTL1) ELISA kit

E01A1426-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiomotin like protein 2(AMOTL2) ELISA kit

E01A1427-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiomotin like protein 2(AMOTL2) ELISA kit

E01A1427-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiomotin like protein 2(AMOTL2) ELISA kit

E01A1427-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Angiomotin-like protein 1

EK4486 SAB 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Angiomotin-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human AMOTL1(Angiomotin-like protein 1) ELISA Kit

EH2206 FN Test 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q8IY63
  • Alias: AMOTL1/JEAP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Angiomotin- like protein 1, AMOTL1 ELISA KIT

ELI-07351h Lifescience Market 96 Tests
EUR 824

Human Angiomotin- like protein 2, AMOTL2 ELISA KIT

ELI-07353h Lifescience Market 96 Tests
EUR 824

Human Angiomotin-like protein 1 (AMOTL1) ELISA Kit

abx251548-96tests Abbexa 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human AMOTL1/ Angiomotin-like protein 1 ELISA Kit

E0138Hu Sunlong 1 Kit
EUR 571

Human AMOTL2/ Angiomotin-like protein 2 ELISA Kit

E0139Hu Sunlong 1 Kit
EUR 571

AMOT Conjugated Antibody

C45767 SAB 100ul
EUR 397

anti- AMOT antibody

FNab00366 FN Test 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: angiomotin
  • Uniprot ID: Q4VCS5
  • Gene ID: 154796
  • Research Area: Cardiovascular, Developmental biology
Description: Antibody raised against AMOT

anti- AMOT antibody

FNab00367 FN Test 100µg
EUR 505.25
  • Immunogen: angiomotin
  • Uniprot ID: Q4VCS5
  • Gene ID: 154796
  • Research Area: Cardiovascular, Developmental biology
Description: Antibody raised against AMOT

anti- AMOT antibody

FNab00368 FN Test 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:10000
  • IHC: 1:20-1:200
  • Immunogen: angiomotin
  • Uniprot ID: Q4VCS5
  • Gene ID: 154796
  • Research Area: Cardiovascular, Developmental biology
Description: Antibody raised against AMOT

anti- AMOT antibody

FNab09852 FN Test 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:200-1:1000
  • IHC: 1:50-1:500
  • IF: 1:20-1:200
  • Immunogen: angiomotin
  • Uniprot ID: Q4VCS5
  • Gene ID: 154796
  • Research Area: Cardiovascular, Developmental biology
Description: Antibody raised against AMOT

AMOT Polyclonal Antibody

ES9390-100ul ELK Biotech 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AMOT from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

AMOT Polyclonal Antibody

ES9390-50ul ELK Biotech 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AMOT from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

AMOT Polyclonal Antibody

ABP57755-003ml Abbkine 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790
  • Applications tips:
Description: A polyclonal antibody for detection of AMOT from Human, Mouse. This AMOT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790

AMOT Polyclonal Antibody

ABP57755-01ml Abbkine 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790
  • Applications tips:
Description: A polyclonal antibody for detection of AMOT from Human, Mouse. This AMOT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790

AMOT Polyclonal Antibody

ABP57755-02ml Abbkine 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790
  • Applications tips:
Description: A polyclonal antibody for detection of AMOT from Human, Mouse. This AMOT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790

AMOT (pS1041) Antibody

abx032118-400ul Abbexa 400 ul
EUR 523
  • Shipped within 5-10 working days.

AMOT (pS1041) Antibody

abx032118-80l Abbexa 80 µl
EUR 286
  • Shipped within 5-10 working days.

AMOT (pY599) Antibody

abx032202-400ul Abbexa 400 ul
EUR 523
  • Shipped within 5-10 working days.

AMOT (pY599) Antibody

abx032202-80l Abbexa 80 µl
EUR 286
  • Shipped within 5-10 working days.

AMOT Rabbit pAb

A8075-100ul Abclonal 100 ul
EUR 308

AMOT Rabbit pAb

A8075-200ul Abclonal 200 ul
EUR 459

AMOT Rabbit pAb

A8075-20ul Abclonal 20 ul
EUR 183

AMOT Rabbit pAb

A8075-50ul Abclonal 50 ul
EUR 223

AMOT Blocking Peptide

DF9208-BP Affbiotech 1mg
EUR 195

AMOT cloning plasmid

CSB-CL001677HU-10ug Cusabio 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2031
  • Sequence: atgcctcgggctcagccatcctctgcttcttatcagccagtgccagcagacccttttgccattgtttccagagcccagcagatggttgagatcctctcagacgagaaccggaacttgaggcaagagttggaaggatgctatgagaaggtggcaagactgcagaaggtggagacag
  • Show more
Description: A cloning plasmid for the AMOT gene.

Anti-AMOT antibody

PAab00366 Lifescience Market 100 ug
EUR 355

anti- AMOT antibody

LSMab09852 Lifescience Market 100 ug
EUR 386

Anti-AMOT antibody

STJ110378 St John's Laboratory 100 µl
EUR 277
Description: This gene belongs to the motin family of angiostatin binding proteins characterized by conserved coiled-coil domains and C-terminal PDZ binding motifs. The encoded protein is expressed predominantly in endothelial cells of capillaries as well as larger vessels of the placenta where it may mediate the inhibitory effect of angiostatin on tube formation and the migration of endothelial cells toward growth factors during the formation of new blood vessels. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-AMOT antibody

STJ190548 St John's Laboratory 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AMOT

AMOT ORF Vector (Human) (pORF)

ORF012200 ABM 1.0 ug DNA
EUR 354

Anti-Angiomotin (2A8)

YF-MA19968 Abfrontier 100 ug
EUR 363
Description: Mouse monoclonal to Angiomotin

Frit Kit

FRIT-KIT Next Advance 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse Angiomotin-like protein 1 (AMOTL1) ELISA Kit

abx520012-96tests Abbexa 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Angiomotin-like protein 2 (AMOTL2) ELISA Kit

abx520014-96tests Abbexa 96 tests
EUR 668
  • Shipped within 5-12 working days.

Goat Angiomotin like protein 1(AMOTL1) ELISA kit

E06A1426-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Angiomotin like protein 1(AMOTL1) ELISA kit

E06A1426-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Angiomotin like protein 1(AMOTL1) ELISA kit

E06A1426-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Angiomotin like protein 2(AMOTL2) ELISA kit

E06A1427-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Angiomotin like protein 2(AMOTL2) ELISA kit

E06A1427-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Angiomotin like protein 2(AMOTL2) ELISA kit

E06A1427-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Angiomotin like protein 1(AMOTL1) ELISA kit

E02A1426-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Angiomotin like protein 1(AMOTL1) ELISA kit

E02A1426-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Angiomotin like protein 1(AMOTL1) ELISA kit

E02A1426-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Angiomotin like protein 2(AMOTL2) ELISA kit

E02A1427-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Angiomotin like protein 2(AMOTL2) ELISA kit

E02A1427-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Angiomotin like protein 2(AMOTL2) ELISA kit

E02A1427-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Angiomotin like protein 1(AMOTL1) ELISA kit

E03A1426-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Angiomotin like protein 1(AMOTL1) ELISA kit

E03A1426-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Angiomotin like protein 1(AMOTL1) ELISA kit

E03A1426-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Angiomotin like protein 2(AMOTL2) ELISA kit

E03A1427-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Angiomotin like protein 2(AMOTL2) ELISA kit

E03A1427-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Angiomotin like protein 2(AMOTL2) ELISA kit

E03A1427-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Angiomotin like protein 1(AMOTL1) ELISA kit

E04A1426-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Angiomotin like protein 1(AMOTL1) ELISA kit

E04A1426-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Angiomotin like protein 1(AMOTL1) ELISA kit

E04A1426-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Angiomotin like protein 2(AMOTL2) ELISA kit

E04A1427-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Angiomotin like protein 2(AMOTL2) ELISA kit

E04A1427-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Angiomotin like protein 2(AMOTL2) ELISA kit

E04A1427-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Angiomotin like protein 1(AMOTL1) ELISA kit

E07A1426-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Angiomotin like protein 1(AMOTL1) ELISA kit

E07A1426-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Angiomotin like protein 1(AMOTL1) ELISA kit

E07A1426-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Angiomotin like protein 2(AMOTL2) ELISA kit

E07A1427-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Angiomotin like protein 2(AMOTL2) ELISA kit

E07A1427-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Angiomotin like protein 2(AMOTL2) ELISA kit

E07A1427-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Angiomotin like protein 1(AMOTL1) ELISA kit

E09A1426-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Angiomotin like protein 1(AMOTL1) ELISA kit

E09A1426-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Angiomotin like protein 1(AMOTL1) ELISA kit

E09A1426-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Angiomotin like protein 2(AMOTL2) ELISA kit

E09A1427-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Angiomotin like protein 2(AMOTL2) ELISA kit

E09A1427-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Angiomotin like protein 2(AMOTL2) ELISA kit

E09A1427-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Angiomotin like protein 1(AMOTL1) ELISA kit

E08A1426-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Angiomotin like protein 1(AMOTL1) ELISA kit

E08A1426-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Angiomotin like protein 1(AMOTL1) ELISA kit

E08A1426-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Angiomotin like protein 2(AMOTL2) ELISA kit

E08A1427-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Angiomotin like protein 2(AMOTL2) ELISA kit

E08A1427-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Angiomotin like protein 2(AMOTL2) ELISA kit

E08A1427-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Angiomotin- like protein 1, Amotl1 ELISA KIT

ELI-07350m Lifescience Market 96 Tests
EUR 865

Mouse Angiomotin- like protein 2, Amotl2 ELISA KIT

ELI-07352m Lifescience Market 96 Tests
EUR 865

Mouse AMOT shRNA Plasmid

20-abx973921 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Column Packing Kit

PACK-KIT Next Advance 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

AMOT sgRNA CRISPR Lentivector set (Human)

K0081801 ABM 3 x 1.0 ug
EUR 339

PCR Mycoplasma Detection Kit

M034-Kit TOKU-E Kit
EUR 266

Angiomotin-L1 Polyclonal Antibody

ES4925-100ul ELK Biotech 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Angiomotin-L1 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

Angiomotin-L1 Polyclonal Antibody

ES4925-50ul ELK Biotech 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Angiomotin-L1 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

Angiomotin-L1 Polyclonal Antibody

ABP53926-003ml Abbkine 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Angiomotin-L1 at AA rangle: 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of Angiomotin-L1 from Human, Mouse. This Angiomotin-L1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Angiomotin-L1 at AA rangle: 410-490

Angiomotin-L1 Polyclonal Antibody

ABP53926-01ml Abbkine 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Angiomotin-L1 at AA rangle: 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of Angiomotin-L1 from Human, Mouse. This Angiomotin-L1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Angiomotin-L1 at AA rangle: 410-490

Angiomotin-L1 Polyclonal Antibody

ABP53926-02ml Abbkine 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Angiomotin-L1 at AA rangle: 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of Angiomotin-L1 from Human, Mouse. This Angiomotin-L1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Angiomotin-L1 at AA rangle: 410-490

Anti-Angiomotin-L1 antibody

STJ91593 St John's Laboratory 200 µl
EUR 197
Description: Rabbit polyclonal to Angiomotin-L1.

anti-Angiomotin like 1

YF-PA22513 Abfrontier 50 ug
EUR 363
Description: Mouse polyclonal to Angiomotin like 1

anti-Angiomotin like 1

YF-PA22514 Abfrontier 100 ug
EUR 403
Description: Rabbit polyclonal to Angiomotin like 1

Recombinant human Angiomotin-like protein 1

P1563 FN Test 100ug Ask for price
  • Uniprot ID: Q8IY63
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Angiomotin-like protein 1

Recombinant human Angiomotin-like protein 2

P1567 FN Test 100ug Ask for price
  • Uniprot ID: Q9Y2J4
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Angiomotin-like protein 2

Guinea pig Angiomotin like protein 1(AMOTL1) ELISA kit

E05A1426-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Angiomotin like protein 1(AMOTL1) ELISA kit

E05A1426-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Angiomotin like protein 1(AMOTL1) ELISA kit

E05A1426-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Angiomotin like protein 1(AMOTL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Angiomotin like protein 2(AMOTL2) ELISA kit

E05A1427-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Angiomotin like protein 2(AMOTL2) ELISA kit

E05A1427-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Angiomotin like protein 2(AMOTL2) ELISA kit

E05A1427-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Angiomotin like protein 2(AMOTL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human AMOT(Angiomotin) ELISA Kit

Recent Posts
  • ANTIBODY FINDER, PROTEINS AND ELISA KITS
  • QPCR Troubleshooting Guide
  • An up-to-date review on bio-resource therapeutics effective against bacterial species frequently associated with chronic sinusitis and tonsillitis
  • Bio-Fabrication: Convergence of 3D Bioprinting and Nano-Biomaterials in Tissue Engineering and Regenerative Medicine
  • Recognition of Patient Groups with Sleep Related Disorders using Bio-signal Processing and Deep Learning
Categories
  • An up-to-date review on bio-resource therapeutics effective against bacterial species frequently associated with chronic sinusitis and tonsillitis.
  • Bio-chemo-electro-mechanical modelling of the rapid movement of Mimosa pudica
  • Bio-Fabrication: Convergence of 3D Bioprinting and Nano-Biomaterials in Tissue Engineering and Regenerative Medicine
  • Exploring the additive bio-agent impacts upon ectoine production by Halomonas salina DSM5928T using corn steep liquor and soybean hydrolysate as nutrient supplement
  • Recognition of Patient Groups with Sleep Related Disorders using Bio-signal Processing and Deep Learning
  • Uncategorized

© 2019 All Right Reserved | Arowana WordPress Theme