Human HAL(Histidine Ammonia Lyase) ELISA Kit

Human HAL(Histidine Ammonia Lyase) ELISA Kit

Human Histidine Ammonia Lyase (HAL) ELISA Kit
RDR-HAL-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Histidine Ammonia Lyase (HAL) ELISA Kit
RDR-HAL-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Histidine Ammonia-Lyase (HAL) Antibody
20-abx334175	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Histidine Ammonia Lyase (HAL) ELISA Kit
20-abx156887	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Histidine Ammonia Lyase (HAL) ELISA Kit
SEH932Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Ammonia Lyase (HAL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Ammonia Lyase (HAL) in Tissue homogenates, cell lysates and other biological fluids.

Human Histidine Ammonia Lyase (HAL) ELISA Kit
SEH932Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Ammonia Lyase (HAL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Ammonia Lyase (HAL) in Tissue homogenates, cell lysates and other biological fluids.

Human Histidine Ammonia Lyase (HAL) ELISA Kit
SEH932Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Ammonia Lyase (HAL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Ammonia Lyase (HAL) in Tissue homogenates, cell lysates and other biological fluids.

Human Histidine Ammonia Lyase (HAL) ELISA Kit
SEH932Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Ammonia Lyase (HAL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Ammonia Lyase (HAL) in Tissue homogenates, cell lysates and other biological fluids.

Human Histidine Ammonia Lyase (HAL) ELISA Kit
4-SEH932Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Histidine Ammonia Lyase elisa. Alternative names of the recognized antigen: HIS Histidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histidine Ammonia Lyase (HAL) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Histidine Ammonia-Lyase (HAL) ELISA Kit
abx389551-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Histidine Ammonia-Lyase (HAL) ELISA Kit
abx391456-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Histidine Ammonia Lyase (HAL) CLIA Kit
20-abx495586	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Histidine Ammonia-Lyase (HAL) Antibody (HRP)
20-abx335961	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Histidine Ammonia-Lyase (HAL) Antibody (FITC)
20-abx335962	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Histidine Ammonia-Lyase (HAL) Antibody (Biotin)
20-abx335963	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Human HAL (Histidine Ammonia Lyase)
ELK5180	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histidine Ammonia Lyase (HAL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Hist Show more
Description: A sandwich ELISA kit for detection of Histidine Ammonia Lyase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human HAL (Histidine ammonia-lyase) ELISA Kit (CUSTOM)
ELI-48714h	Lifescience Market	96 Tests	EUR 824

Bovine HAL (Histidine ammonia-lyase) ELISA Kit (CUSTOM)
ELI-14312b	Lifescience Market	96 Tests	EUR 928

Mouse HAL (Histidine ammonia-lyase) ELISA Kit (CUSTOM)
ELI-20226m	Lifescience Market	96 Tests	EUR 865

Rat HAL (Histidine ammonia-lyase) ELISA Kit (CUSTOM)
ELI-38660r	Lifescience Market	96 Tests	EUR 886

Hal ELISA Kit| Rat Histidine ammonia-lyase ELISA Kit
EF018814	Lifescience Market	96 Tests	EUR 689

Hal ELISA Kit| Mouse Histidine ammonia-lyase ELISA Kit
EF015185	Lifescience Market	96 Tests	EUR 689

HAL ELISA Kit| Bovine Histidine ammonia-lyase ELISA Kit
EF011495	Lifescience Market	96 Tests	EUR 689

Human L Phenylalanine ammonia lyase ELISA kit
E01P0597-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L Phenylalanine ammonia lyase ELISA kit
E01P0597-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L Phenylalanine ammonia lyase ELISA kit
E01P0597-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Phenylalanine ammonia-lyase Assay Kit
abx097984-100Assays	Abbexa	100 Assays	EUR 535
Shipped within 5-10 working days.

Rat L Phenylalanine ammonia lyase ELISA kit
E02P0597-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat L Phenylalanine ammonia lyase ELISA kit
E02P0597-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat L Phenylalanine ammonia lyase ELISA kit
E02P0597-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse L Phenylalanine ammonia lyase ELISA kit
E03P0597-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse L Phenylalanine ammonia lyase ELISA kit
E03P0597-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse L Phenylalanine ammonia lyase ELISA kit
E03P0597-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit L Phenylalanine ammonia lyase ELISA kit
E04P0597-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit L Phenylalanine ammonia lyase ELISA kit
E04P0597-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit L Phenylalanine ammonia lyase ELISA kit
E04P0597-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat L Phenylalanine ammonia lyase ELISA kit
E06P0597-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat L Phenylalanine ammonia lyase ELISA kit
E06P0597-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat L Phenylalanine ammonia lyase ELISA kit
E06P0597-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig L Phenylalanine ammonia lyase ELISA kit
E07P0597-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig L Phenylalanine ammonia lyase ELISA kit
E07P0597-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig L Phenylalanine ammonia lyase ELISA kit
E07P0597-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog L Phenylalanine ammonia lyase ELISA kit
E08P0597-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog L Phenylalanine ammonia lyase ELISA kit
E08P0597-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog L Phenylalanine ammonia lyase ELISA kit
E08P0597-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey L Phenylalanine ammonia lyase ELISA kit
E09P0597-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey L Phenylalanine ammonia lyase ELISA kit
E09P0597-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey L Phenylalanine ammonia lyase ELISA kit
E09P0597-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig L Phenylalanine ammonia lyase ELISA kit
E05P0597-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig L Phenylalanine ammonia lyase ELISA kit
E05P0597-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig L Phenylalanine ammonia lyase ELISA kit
E05P0597-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse L-Phenylalanine ammonia-lyase (PAL) ELISA Kit
abx350370-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Ethanolamine ammonia-lyase light chain Antibody
20-abx110555	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

L-Phenylalanine Ammonia-Lyase (pal) Antibody
20-abx300213	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ethanolamine ammonia-lyase light chain Antibody (HRP)
20-abx109116	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ethanolamine ammonia-lyase light chain Antibody (Biotin)
20-abx106284	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ethanolamine ammonia-lyase light chain Antibody (FITC)
20-abx107698	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

L-Phenylalanine Ammonia-Lyase (pal) Antibody (HRP)
20-abx300214	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

L-Phenylalanine Ammonia-Lyase (pal) Antibody (FITC)
20-abx300215	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

L-Phenylalanine Ammonia-Lyase (pal) Antibody (Biotin)
20-abx300216	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

HAL ELISA KIT|Human
EF010056	Lifescience Market	96 Tests	EUR 689

Escherichia coli Ethanolamine ammonia-lyase light chain (eutC)
1-CSB-EP323953ENV	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 35.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli Ethanolamine ammonia-lyase light chain(eutC) expressed in E.coli

HAL ELISA Kit (Human) (OKCD01977)
OKCD01977	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Histidine ammonia-lyase is a cytosolic enzyme catalyzing the first reaction in histidine catabolism, the nonoxidative deamination of L-histidine to trans-urocanic acid. Histidine ammonia-lyase defects cause histidinemia which is characterized by increased histidine and histamine and decreased urocanic acid in body fluids. Several transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

Ammonia Assay Kit
55R-1388	Fitzgerald	100 assays	EUR 740
Description: Assay Kit for detection of Ammonia in the research laboratory

Ammonia Assay Kit
55R-1410	Fitzgerald	100 assays	EUR 740
Description: Assay Kit for detection of Ammonia in the research laboratory

Ammonia Assay Kit
MET-5086	Cell Biolabs	100 assays	EUR 456

Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-100ug
QP8927-ec-100ug	EnQuireBio	100ug	EUR 707

Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-10ug
QP8927-ec-10ug	EnQuireBio	10ug	EUR 326

Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-1mg
QP8927-ec-1mg	EnQuireBio	1mg	EUR 2303

Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-200ug
QP8927-ec-200ug	EnQuireBio	200ug	EUR 1115

Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-500ug
QP8927-ec-500ug	EnQuireBio	500ug	EUR 1514

Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-50ug
QP8927-ec-50ug	EnQuireBio	50ug	EUR 435

HAL siRNA
20-abx902405	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HAL siRNA
20-abx919058	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HAL siRNA
20-abx919059	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HAL antibody
70R-2243	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal HAL antibody raised against the N terminal of HAL

HAL antibody
70R-1179	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal HAL antibody raised against the C terminal of HAL

HAL Antibody
1-CSB-PA010123LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HAL. Recognizes HAL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

ammonia electrode
ISE50B	Consort	ea	EUR 454

TestStrip? Ammonia
M1091-100	Biovision		EUR 294

TestStrip? Ammonia
M1091-200	Biovision		EUR 436

TestStrip? Ammonia
M1091-50	Biovision		EUR 207

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

EnzyChrom Ammonia Assay Kit
ENH3-100	BioAssay Systems	100	EUR 329
Description: Quantitative determination of ammonia/ammonium concentration by colorimetric (340nm) or fluorimetric (360nm/450nm) methods. Kit size: 100 tests. Detection limit: 24 µM. Shelf life: 3 months. Shipping: on ice; storage: -20°C.

Ammonia Colorimetric Assay Kit
K370-100	Biovision		EUR 539

QuantiFluo Ammonia Assay Kit
DNH3-200	BioAssay Systems	200	EUR 189
Description: Quantitative determination of ammonia/ammonium concentration by fluorimetry at 360nm/450nm (compatible on handheld fluorimeter catalog# FL360450). Kit size: 200 tests. Detection limit: 12 µM. Shelf life: 6 months. Shipping: RT; storage: -20°C.

Human HAL shRNA Plasmid
20-abx952062	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

HAL Recombinant Protein (Human)
RP039709	ABM	100 ug	Ask for price

Human L-Histidine Decarboxylase ELISA kit
E01L0411-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L-Histidine Decarboxylase ELISA kit
E01L0411-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L-Histidine Decarboxylase ELISA kit
E01L0411-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 2-oxo-histidine ELISA kit
E01O0854-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 2-oxo-histidine ELISA kit
E01O0854-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 2-oxo-histidine ELISA kit
E01O0854-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Histidine decarboxylase, HDC ELISA KIT
ELI-31927h	Lifescience Market	96 Tests	EUR 824

Human Histidine Decarboxylase (HDC) ELISA Kit
20-abx151779	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Histidine Decarboxylase (HDC) ELISA Kit
DLR-HDC-Hu-48T	DL Develop	48T	EUR 517
Should the Human Histidine Decarboxylase (HDC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Histidine Decarboxylase (HDC) in samples from serum, plasma or other biological fluids.

Human Histidine Decarboxylase (HDC) ELISA Kit
DLR-HDC-Hu-96T	DL Develop	96T	EUR 673
Should the Human Histidine Decarboxylase (HDC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Histidine Decarboxylase (HDC) in samples from serum, plasma or other biological fluids.

Human Histidine Decarboxylase ELISA Kit (HDC)
RK01553	Abclonal	96 Tests	EUR 521

Human Histidine Decarboxylase (HDC) ELISA Kit
RD-HDC-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Histidine Decarboxylase (HDC) ELISA Kit
RD-HDC-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Histidine Decarboxylase (HDC) ELISA Kit
RDR-HDC-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Histidine Decarboxylase (HDC) ELISA Kit
RDR-HDC-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Histidine Decarboxylase(HDC)ELISA Kit
QY-E00052	Qayee Biotechnology	96T	EUR 361

Human Histidine Decarboxylase (HDC) ELISA Kit
SEG476Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Decarboxylase (HDC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Decarboxylase (HDC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Histidine Decarboxylase (HDC) ELISA Kit
SEG476Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Decarboxylase (HDC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Decarboxylase (HDC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Histidine Decarboxylase (HDC) ELISA Kit
SEG476Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Decarboxylase (HDC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Decarboxylase (HDC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Histidine Decarboxylase (HDC) ELISA Kit
SEG476Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Decarboxylase (HDC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Decarboxylase (HDC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Histidine Decarboxylase (HDC) ELISA Kit
4-SEG476Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Histidine Decarboxylase elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histidine Decarboxylase (HDC) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Argininosuccinate lyase(ASL) ELISA kit
E01A1722-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Argininosuccinate lyase(ASL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Argininosuccinate lyase(ASL) ELISA kit
E01A1722-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Argininosuccinate lyase(ASL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Argininosuccinate lyase(ASL) ELISA kit
E01A1722-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Argininosuccinate lyase(ASL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystathionine Gamma Lyase ELISA kit
E01C0834-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystathionine Gamma Lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystathionine Gamma Lyase ELISA kit
E01C0834-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystathionine Gamma Lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystathionine Gamma Lyase ELISA kit
E01C0834-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cystathionine Gamma Lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenylosuccinate lyase(ADSL) ELISA kit
E01A1290-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Adenylosuccinate lyase(ADSL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenylosuccinate lyase(ADSL) ELISA kit
E01A1290-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Adenylosuccinate lyase(ADSL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenylosuccinate lyase(ADSL) ELISA kit
E01A1290-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Adenylosuccinate lyase(ADSL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Lactoylglutathione lyase
EK3552	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Lactoylglutathione lyase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GLO1/ Lactoylglutathione lyase ELISA Kit
E1017Hu	Sunlong	1 Kit	EUR 605

Human ADSL(Adenylosuccinate lyase) ELISA Kit
EH13944	FN Test	96T	EUR 567.6
Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Adenylosuccinate lyase, ADSL ELISA KIT
ELI-14047h	Lifescience Market	96 Tests	EUR 824

Human Selenocysteine lyase, SCLY ELISA KIT
ELI-35813h	Lifescience Market	96 Tests	EUR 824

Human Argininosuccinate lyase, ASL ELISA KIT
ELI-49142h	Lifescience Market	96 Tests	EUR 824

Human Lactoylglutathione lyase, GLO1 ELISA KIT
ELI-38046h	Lifescience Market	96 Tests	EUR 824

Human Selenocysteine lyase (SCLY) ELISA Kit
abx383050-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Argininosuccinate Lyase (ASL) ELISA Kit
abx385897-96tests	Abbexa	96 tests	EUR 911
Shipped within 20 working days.

Human Adenylosuccinate lyase (ADSL) ELISA Kit
abx392197-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human cystathionine-?-lyase,CSE ELISA Kit
201-12-0725	SunredBio	96 tests	EUR 440
This cystathionine-?-lyase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Selenocysteine Lyase(SCLY)ELISA Kit
QY-E01011	Qayee Biotechnology	96T	EUR 361

Human Argininosuccinate Lyase(ASL)ELISA Kit
QY-E02745	Qayee Biotechnology	96T	EUR 394

Human Adenylosuccinate Lyase(ADSL)ELISA Kit
QY-E00877	Qayee Biotechnology	96T	EUR 361

HAL cloning plasmid
CSB-CL010123HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1974 Sequence: ATGCCCAGATACACGGTGCACGTACGTGGGGAATGGCTGGCAGTGCCCTGCCAGGACGCGCAGCTCACTGTGGGCTGGCTGGGCCGGGAGGCCGTGAGGCGCTATATCAAGAATAAGCCCGACAATGGTGGCTTCACCTCCGTGGATGACGCGCACTTCCTTGTGCGCCGGTGCA Show more
Description: A cloning plasmid for the HAL gene.

anti- HAL antibody
FNab03750	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IHC: 1:20-1:200 Immunogen: histidine ammonia-lyase Uniprot ID: P42357 Gene ID: 3034 Research Area: Metabolism
Description: Antibody raised against HAL

Histidase (HAL) Antibody
abx145990-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Histidase (HAL) Antibody
abx233750-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

HAL Rabbit pAb
A13021-100ul	Abclonal	100 ul	EUR 308

HAL Rabbit pAb
A13021-200ul	Abclonal	200 ul	EUR 459

HAL Rabbit pAb
A13021-20ul	Abclonal	20 ul	EUR 183

HAL Rabbit pAb
A13021-50ul	Abclonal	50 ul	EUR 223

HAL Polyclonal Antibody
A69535	EpiGentek	100 ?g	EUR 628.55
Description: fast delivery possible

HAL Blocking Peptide
33R-4075	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HAL antibody, catalog no. 70R-2243

HAL Blocking Peptide
33R-2249	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HAL antibody, catalog no. 70R-1179

HAL Polyclonal Antibody
27864-100ul	SAB	100ul	EUR 252

HAL Polyclonal Antibody
27864-50ul	SAB	50ul	EUR 187

Anti-HAL antibody
PAab03750	Lifescience Market	100 ug	EUR 386

Anti-HAL antibody
STJ114988	St John's Laboratory	100 µl	EUR 277
Description: Histidine ammonia-lyase is a cytosolic enzyme catalyzing the first reaction in histidine catabolism, the nonoxidative deamination of L-histidine to trans-urocanic acid. Histidine ammonia-lyase defects cause histidinemia which is characterized by increased histidine and histamine and decreased urocanic acid in body fluids. Several transcript variants encoding different isoforms have been found for this gene.

Ammonia Colorimetric Assay Kit II
K470-100	Biovision		EUR 539

calibration solution ammonia
ISC50	Consort	ea	EUR 91

Borane Ammonia Complex
abx188628-500g	Abbexa	500 g	EUR 1107
Shipped within 1-2 weeks.

Human Carbamoyl-phosphate Synthase [ammonia], Mitochondrial (CPS1) ELISA Kit
20-abx508456	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) ELISA kit
E01C2022-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) ELISA kit
E01C2022-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) ELISA kit
E01C2022-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carbamoyl-phosphate synthase [ammonia], mitochondrial(CPS1) ELISA kit
CSB-EL005913HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Carbamoyl-phosphate synthase [ammonia], mitochondrial (CPS1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Carbamoyl-phosphate synthase [ammonia], mitochondrial(CPS1) ELISA kit
1-CSB-EL005913HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Carbamoyl-phosphate synthase [ammonia], mitochondrial(CPS1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

HAL ORF Vector (Human) (pORF)
ORF013237	ABM	1.0 ug DNA	EUR 354

Human Fragile Histidine Triad (FHIT) ELISA Kit
abx595227-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
abx574921-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Histidine-rich glycoprotein
EK4461	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Histidine-rich glycoprotein in samples from serum, plasma, tissue homogenates and other biological fluids.

Human HRG/ Histidine-rich glycoprotein ELISA Kit
E1164Hu	Sunlong	1 Kit	EUR 571

Human HRG(Histidine-rich glycoprotein) ELISA Kit
EH2191	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P04196 Alias: HRG/HPRG/HRGP/THPH11/Histidine-proline-rich glycoprotein(HPRG)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Histidine- rich glycoprotein, HRG ELISA KIT
ELI-07263h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human HDC (Histidine Decarboxylase)
ELK4150	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histidine Decarboxylase (HDC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Hist Show more
Description: A sandwich ELISA kit for detection of Histidine Decarboxylase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
20-abx151844	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
abx251532-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Fragile Histidine Triad (FHIT) ELISA Kit
abx387358-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
DLR-HRG-Hu-48T	DL Develop	48T	EUR 517
Should the Human Histidine Rich Glycoprotein (HRG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Histidine Rich Glycoprotein (HRG) in samples from serum, plasma or other biological fluids.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
DLR-HRG-Hu-96T	DL Develop	96T	EUR 673
Should the Human Histidine Rich Glycoprotein (HRG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Histidine Rich Glycoprotein (HRG) in samples from serum, plasma or other biological fluids.

Human Histidine-Rich Glycoprotein, HRG ELISA Kit
DEIA254	Creative Diagnostics	5 plates	EUR 1361
Description: The human HRG ELISA kit is for the quantitative determination of human HRG.

Human histidine-rich glycoprotein (HRG) ELISA kit
CSB-E13159h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human histidine-rich glycoprotein (HRG) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human histidine-rich glycoprotein (HRG) ELISA kit
1-CSB-E13159h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human histidine-rich glycoprotein (HRG) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human fragile histidine triad (FHIT) ELISA Kit
CSB-E14182h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human fragile histidine triad (FHIT) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human fragile histidine triad (FHIT) ELISA Kit
1-CSB-E14182h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human fragile histidine triad (FHIT) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
SEC534Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Rich Glycoprotein (HRG) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Rich Glycoprotein (HRG) in serum, plasma and other biological fluids.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
SEC534Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Rich Glycoprotein (HRG) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Rich Glycoprotein (HRG) in serum, plasma and other biological fluids.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
SEC534Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Rich Glycoprotein (HRG) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Rich Glycoprotein (HRG) in serum, plasma and other biological fluids.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
SEC534Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Rich Glycoprotein (HRG) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Rich Glycoprotein (HRG) in serum, plasma and other biological fluids.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
4-SEC534Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Histidine Rich Glycoprotein elisa. Alternative names of the recognized antigen: HPRG HRGP Histidine-Proline Rich Glycoprotein Thrombophilia Due To Elevated HRG
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histidine Rich Glycoprotein (HRG) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Histidine Rich Glycoprotein ELISA Kit (HRG)
RK01587	Abclonal	96 Tests	EUR 521

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
RD-HRG-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
RD-HRG-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
RDR-HRG-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
RDR-HRG-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Histidine Rich Glycoprotein(HRG)ELISA Kit
QY-E00053	Qayee Biotechnology	96T	EUR 361

Human N acetylneuraminate lyase(NPL) ELISA kit
E01N0555-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acetylneuraminate lyase(NPL) ELISA kit
E01N0555-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acetylneuraminate lyase(NPL) ELISA kit
E01N0555-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CTH/ Cystathionine gamma-lyase ELISA Kit
E0590Hu	Sunlong	1 Kit	EUR 571

ELISA kit for Human Cystathionine gamma-lyase
EK3769	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cystathionine gamma-lyase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CTH(Cystathionine gamma-lyase) ELISA Kit
EH1799	FN Test	96T	EUR 567.6
Detection range: 0.78-50 ng/ml Uniprot ID: P32929 Alias: CTH/Cystathionine gamma-lyase/Gamma-cystathionase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human N- acetylneuraminate lyase, NPL ELISA KIT
ELI-21267h	Lifescience Market	96 Tests	EUR 824

Human Cystathionine gamma- lyase, CTH ELISA KIT
ELI-05064h	Lifescience Market	96 Tests	EUR 824

Human cystathionine-γ-lyase(CSE)ELISA Kit
GA-E0741HM-48T	GenAsia Biotech	48T	EUR 289

Human cystathionine-γ-lyase(CSE)ELISA Kit
GA-E0741HM-96T	GenAsia Biotech	96T	EUR 466

Human Cystathionine gamma Lyase (CSE) ELISA Kit
20-abx151193	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human N-acetylneuraminate lyase (NPL) ELISA Kit
abx381863-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Cystathionine gamma-lyase (CTH) ELISA Kit
abx251107-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
DLR-CSE-Hu-48T	DL Develop	48T	EUR 498
Should the Human Cystathionine Gamma Lyase (CSE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystathionine Gamma Lyase (CSE) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
DLR-CSE-Hu-96T	DL Develop	96T	EUR 647
Should the Human Cystathionine Gamma Lyase (CSE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystathionine Gamma Lyase (CSE) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Cystathionine gamma-lyase(CTH) ELISA kit
CSB-EL006160HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Cystathionine gamma-lyase (CTH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Cystathionine gamma-lyase(CTH) ELISA kit
1-CSB-EL006160HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Cystathionine gamma-lyase(CTH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
SEB538Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystathionine Gamma Lyase (CSE) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystathionine Gamma Lyase (CSE) in tissue homogenates, cell lysates and other biological fluids.

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
SEB538Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystathionine Gamma Lyase (CSE) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystathionine Gamma Lyase (CSE) in tissue homogenates, cell lysates and other biological fluids.

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
SEB538Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystathionine Gamma Lyase (CSE) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystathionine Gamma Lyase (CSE) in tissue homogenates, cell lysates and other biological fluids.

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
SEB538Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystathionine Gamma Lyase (CSE) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystathionine Gamma Lyase (CSE) in tissue homogenates, cell lysates and other biological fluids.

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
4-SEB538Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Cystathionine Gamma Lyase elisa. Alternative names of the recognized antigen: CTH Cystathionase Cysteine-protein sulfhydrase Gamma-cystathionase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cystathionine Gamma Lyase (CSE) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Cystathionine Gamma Lyase ELISA Kit (CSE)
RK01192	Abclonal	96 Tests	EUR 521

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
RDR-CSE-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
RDR-CSE-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
RD-CSE-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
RD-CSE-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human cystathionine-γ-lyase(CSE)ELISA Kit
QY-E00985	Qayee Biotechnology	96T	EUR 361

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Rat L-Histidine Decarboxylase ELISA kit
E02L0411-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human HAL(Histidine Ammonia Lyase) ELISA Kit