Theragen Bio

Research Data

Human HAL(Histidine Ammonia Lyase) ELISA Kit

Human HAL(Histidine Ammonia Lyase) ELISA Kit

Human Histidine Ammonia Lyase (HAL) ELISA Kit
RD-HAL-Hu-48Tests 48 Tests
EUR 478

Human Histidine Ammonia Lyase (HAL) ELISA Kit
RD-HAL-Hu-96Tests 96 Tests
EUR 662

Histidine Ammonia-Lyase (HAL) Antibody
20-abx334175
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Histidine Ammonia Lyase (HAL) ELISA Kit
20-abx156887
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Histidine Ammonia Lyase (HAL) ELISA Kit
SEH932Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Ammonia Lyase (HAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Ammonia Lyase (HAL) in Tissue homogenates, cell lysates and other biological fluids.

Human Histidine Ammonia Lyase (HAL) ELISA Kit
SEH932Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Ammonia Lyase (HAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Ammonia Lyase (HAL) in Tissue homogenates, cell lysates and other biological fluids.

Human Histidine Ammonia Lyase (HAL) ELISA Kit
SEH932Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Ammonia Lyase (HAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Ammonia Lyase (HAL) in Tissue homogenates, cell lysates and other biological fluids.

Human Histidine Ammonia Lyase (HAL) ELISA Kit
SEH932Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Ammonia Lyase (HAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Ammonia Lyase (HAL) in Tissue homogenates, cell lysates and other biological fluids.

Human Histidine Ammonia Lyase (HAL) ELISA Kit
4-SEH932Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Histidine Ammonia Lyase elisa. Alternative names of the recognized antigen: HIS
  • Histidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histidine Ammonia Lyase (HAL) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Histidine Ammonia-Lyase (HAL) ELISA Kit
abx391456-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Histidine Ammonia-Lyase (HAL) ELISA Kit
abx389551-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Histidine Ammonia Lyase (HAL) CLIA Kit
20-abx495586
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Histidine Ammonia-Lyase (HAL) Antibody (HRP)
20-abx335961
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Histidine Ammonia-Lyase (HAL) Antibody (FITC)
20-abx335962
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Histidine Ammonia-Lyase (HAL) Antibody (Biotin)
20-abx335963
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Human HAL (Histidine Ammonia Lyase)
ELK5180 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histidine Ammonia Lyase (HAL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Hist
  • Show more
Description: A sandwich ELISA kit for detection of Histidine Ammonia Lyase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human HAL (Histidine ammonia-lyase) ELISA Kit (CUSTOM)
ELI-48714h 96 Tests
EUR 824

Bovine HAL (Histidine ammonia-lyase) ELISA Kit (CUSTOM)
ELI-14312b 96 Tests
EUR 928

Mouse HAL (Histidine ammonia-lyase) ELISA Kit (CUSTOM)
ELI-20226m 96 Tests
EUR 865

Rat HAL (Histidine ammonia-lyase) ELISA Kit (CUSTOM)
ELI-38660r 96 Tests
EUR 886

Hal ELISA Kit| Rat Histidine ammonia-lyase ELISA Kit
EF018814 96 Tests
EUR 689

Hal ELISA Kit| Mouse Histidine ammonia-lyase ELISA Kit
EF015185 96 Tests
EUR 689

HAL ELISA Kit| Bovine Histidine ammonia-lyase ELISA Kit
EF011495 96 Tests
EUR 689

Human L Phenylalanine ammonia lyase ELISA kit
E01P0597-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L Phenylalanine ammonia lyase ELISA kit
E01P0597-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L Phenylalanine ammonia lyase ELISA kit
E01P0597-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Phenylalanine ammonia-lyase Assay Kit
abx097984-100Assays 100 Assays
EUR 535
  • Shipped within 5-10 working days.

Rat L Phenylalanine ammonia lyase ELISA kit
E02P0597-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat L Phenylalanine ammonia lyase ELISA kit
E02P0597-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat L Phenylalanine ammonia lyase ELISA kit
E02P0597-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit L Phenylalanine ammonia lyase ELISA kit
E04P0597-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit L Phenylalanine ammonia lyase ELISA kit
E04P0597-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit L Phenylalanine ammonia lyase ELISA kit
E04P0597-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse L Phenylalanine ammonia lyase ELISA kit
E03P0597-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse L Phenylalanine ammonia lyase ELISA kit
E03P0597-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse L Phenylalanine ammonia lyase ELISA kit
E03P0597-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog L Phenylalanine ammonia lyase ELISA kit
E08P0597-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog L Phenylalanine ammonia lyase ELISA kit
E08P0597-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog L Phenylalanine ammonia lyase ELISA kit
E08P0597-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat L Phenylalanine ammonia lyase ELISA kit
E06P0597-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat L Phenylalanine ammonia lyase ELISA kit
E06P0597-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat L Phenylalanine ammonia lyase ELISA kit
E06P0597-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig L Phenylalanine ammonia lyase ELISA kit
E07P0597-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig L Phenylalanine ammonia lyase ELISA kit
E07P0597-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig L Phenylalanine ammonia lyase ELISA kit
E07P0597-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey L Phenylalanine ammonia lyase ELISA kit
E09P0597-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey L Phenylalanine ammonia lyase ELISA kit
E09P0597-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey L Phenylalanine ammonia lyase ELISA kit
E09P0597-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig L Phenylalanine ammonia lyase ELISA kit
E05P0597-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig L Phenylalanine ammonia lyase ELISA kit
E05P0597-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig L Phenylalanine ammonia lyase ELISA kit
E05P0597-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse L-Phenylalanine ammonia-lyase (PAL) ELISA Kit
abx350370-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Ethanolamine ammonia-lyase light chain Antibody
20-abx110555
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

L-Phenylalanine Ammonia-Lyase (pal) Antibody
20-abx300213
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ethanolamine ammonia-lyase light chain Antibody (Biotin)
20-abx106284
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ethanolamine ammonia-lyase light chain Antibody (FITC)
20-abx107698
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ethanolamine ammonia-lyase light chain Antibody (HRP)
20-abx109116
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

L-Phenylalanine Ammonia-Lyase (pal) Antibody (HRP)
20-abx300214
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

L-Phenylalanine Ammonia-Lyase (pal) Antibody (FITC)
20-abx300215
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

L-Phenylalanine Ammonia-Lyase (pal) Antibody (Biotin)
20-abx300216
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

HAL ELISA KIT|Human
EF010056 96 Tests
EUR 689

Escherichia coli Ethanolamine ammonia-lyase light chain (eutC)
1-CSB-EP323953ENV
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 35.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli Ethanolamine ammonia-lyase light chain(eutC) expressed in E.coli

HAL ELISA Kit (Human) (OKCD01977)
OKCD01977 96 Wells
EUR 831
Description: Description of target: Histidine ammonia-lyase is a cytosolic enzyme catalyzing the first reaction in histidine catabolism, the nonoxidative deamination of L-histidine to trans-urocanic acid. Histidine ammonia-lyase defects cause histidinemia which is characterized by increased histidine and histamine and decreased urocanic acid in body fluids. Several transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

Ammonia Assay Kit
55R-1388 100 assays
EUR 740
Description: Assay Kit for detection of Ammonia in the research laboratory

Ammonia Assay Kit
55R-1410 100 assays
EUR 740
Description: Assay Kit for detection of Ammonia in the research laboratory

Ammonia Assay Kit
MET-5086 100 assays
EUR 456

Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-100ug
QP8927-ec-100ug 100ug
EUR 707

Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-10ug
QP8927-ec-10ug 10ug
EUR 326

Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-1mg
QP8927-ec-1mg 1mg
EUR 2303

Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-200ug
QP8927-ec-200ug 200ug
EUR 1115

Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-500ug
QP8927-ec-500ug 500ug
EUR 1514

Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-50ug
QP8927-ec-50ug 50ug
EUR 435

HAL antibody
70R-1179 100 ug
EUR 377
Description: Rabbit polyclonal HAL antibody raised against the C terminal of HAL

HAL antibody
70R-2243 50 ug
EUR 467
Description: Rabbit polyclonal HAL antibody raised against the N terminal of HAL

HAL Antibody
1-CSB-PA010123LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HAL. Recognizes HAL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

HAL siRNA
20-abx902405
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HAL siRNA
20-abx919058
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HAL siRNA
20-abx919059
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ammonia electrode
ISE50B ea
EUR 454

TestStrip? Ammonia
M1091-100
EUR 294

TestStrip? Ammonia
M1091-200
EUR 436

TestStrip? Ammonia
M1091-50
EUR 207

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

QuantiFluo Ammonia Assay Kit
DNH3-200 200
EUR 189
Description: Quantitative determination of ammonia/ammonium concentration by fluorimetry at 360nm/450nm (compatible on handheld fluorimeter catalog# FL360450). Kit size: 200 tests. Detection limit: 12 µM. Shelf life: 6 months. Shipping: RT; storage: -20°C.

EnzyChrom Ammonia Assay Kit
ENH3-100 100
EUR 329
Description: Quantitative determination of ammonia/ammonium concentration by colorimetric (340nm) or fluorimetric (360nm/450nm) methods. Kit size: 100 tests. Detection limit: 24 µM. Shelf life: 3 months. Shipping: on ice; storage: -20°C.

Ammonia Colorimetric Assay Kit
K370-100
EUR 539

Human HAL shRNA Plasmid
20-abx952062
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HAL Recombinant Protein (Human)
RP039709 100 ug Ask for price

Human Histidine Decarboxylase (HDC) ELISA Kit
DLR-HDC-Hu-48T 48T
EUR 517
  • Should the Human Histidine Decarboxylase (HDC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Histidine Decarboxylase (HDC) in samples from serum, plasma or other biological fluids.

Human Histidine Decarboxylase (HDC) ELISA Kit
DLR-HDC-Hu-96T 96T
EUR 673
  • Should the Human Histidine Decarboxylase (HDC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Histidine Decarboxylase (HDC) in samples from serum, plasma or other biological fluids.

Human L-Histidine Decarboxylase ELISA kit
E01L0411-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L-Histidine Decarboxylase ELISA kit
E01L0411-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human L-Histidine Decarboxylase ELISA kit
E01L0411-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 2-oxo-histidine ELISA kit
E01O0854-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 2-oxo-histidine ELISA kit
E01O0854-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 2-oxo-histidine ELISA kit
E01O0854-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Histidine Decarboxylase (HDC) ELISA Kit
20-abx151779
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Histidine decarboxylase, HDC ELISA KIT
ELI-31927h 96 Tests
EUR 824

Human Histidine Decarboxylase(HDC)ELISA Kit
QY-E00052 96T
EUR 361

Human Histidine Decarboxylase ELISA Kit (HDC)
RK01553 96 Tests
EUR 521

Human Histidine Decarboxylase (HDC) ELISA Kit
RDR-HDC-Hu-48Tests 48 Tests
EUR 544

Human Histidine Decarboxylase (HDC) ELISA Kit
RDR-HDC-Hu-96Tests 96 Tests
EUR 756

Human Histidine Decarboxylase (HDC) ELISA Kit
RD-HDC-Hu-48Tests 48 Tests
EUR 521

Human Histidine Decarboxylase (HDC) ELISA Kit
RD-HDC-Hu-96Tests 96 Tests
EUR 723

Human Histidine Decarboxylase (HDC) ELISA Kit
SEG476Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Decarboxylase (HDC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Decarboxylase (HDC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Histidine Decarboxylase (HDC) ELISA Kit
SEG476Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Decarboxylase (HDC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Decarboxylase (HDC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Histidine Decarboxylase (HDC) ELISA Kit
SEG476Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Decarboxylase (HDC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Decarboxylase (HDC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Histidine Decarboxylase (HDC) ELISA Kit
SEG476Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Decarboxylase (HDC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Decarboxylase (HDC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Histidine Decarboxylase (HDC) ELISA Kit
4-SEG476Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Histidine Decarboxylase elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histidine Decarboxylase (HDC) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human cystathionine-?-lyase,CSE ELISA Kit
201-12-0725 96 tests
EUR 440
  • This cystathionine-?-lyase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cystathionine Gamma Lyase ELISA kit
E01C0834-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystathionine Gamma Lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystathionine Gamma Lyase ELISA kit
E01C0834-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystathionine Gamma Lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cystathionine Gamma Lyase ELISA kit
E01C0834-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cystathionine Gamma Lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenylosuccinate lyase(ADSL) ELISA kit
E01A1290-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Adenylosuccinate lyase(ADSL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenylosuccinate lyase(ADSL) ELISA kit
E01A1290-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Adenylosuccinate lyase(ADSL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adenylosuccinate lyase(ADSL) ELISA kit
E01A1290-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Adenylosuccinate lyase(ADSL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Argininosuccinate lyase(ASL) ELISA kit
E01A1722-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Argininosuccinate lyase(ASL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Argininosuccinate lyase(ASL) ELISA kit
E01A1722-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Argininosuccinate lyase(ASL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Argininosuccinate lyase(ASL) ELISA kit
E01A1722-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Argininosuccinate lyase(ASL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Lactoylglutathione lyase
EK3552 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Lactoylglutathione lyase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GLO1/ Lactoylglutathione lyase ELISA Kit
E1017Hu 1 Kit
EUR 605

Human ADSL(Adenylosuccinate lyase) ELISA Kit
EH13944 96T
EUR 567.6
  • Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Adenylosuccinate lyase, ADSL ELISA KIT
ELI-14047h 96 Tests
EUR 824

Human Adenylosuccinate lyase (ADSL) ELISA Kit
abx392197-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Argininosuccinate Lyase (ASL) ELISA Kit
abx385897-96tests 96 tests
EUR 911
  • Shipped within 20 working days.

Human Selenocysteine lyase (SCLY) ELISA Kit
abx383050-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Selenocysteine lyase, SCLY ELISA KIT
ELI-35813h 96 Tests
EUR 824

Human Lactoylglutathione lyase, GLO1 ELISA KIT
ELI-38046h 96 Tests
EUR 824

Human Argininosuccinate lyase, ASL ELISA KIT
ELI-49142h 96 Tests
EUR 824

Human Adenylosuccinate Lyase(ADSL)ELISA Kit
QY-E00877 96T
EUR 361

Human Selenocysteine Lyase(SCLY)ELISA Kit
QY-E01011 96T
EUR 361

Human Argininosuccinate Lyase(ASL)ELISA Kit
QY-E02745 96T
EUR 394

Ammonia Colorimetric Assay Kit II
K470-100
EUR 539

HAL Polyclonal Antibody
27864-100ul 100ul
EUR 252

HAL Polyclonal Antibody
27864-50ul 50ul
EUR 187

HAL Rabbit pAb
A13021-100ul 100 ul
EUR 308

HAL Rabbit pAb
A13021-200ul 200 ul
EUR 459

HAL Rabbit pAb
A13021-20ul 20 ul
EUR 183

HAL Rabbit pAb
A13021-50ul 50 ul
EUR 223

HAL Blocking Peptide
33R-2249 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HAL antibody, catalog no. 70R-1179

HAL Blocking Peptide
33R-4075 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HAL antibody, catalog no. 70R-2243

Histidase (HAL) Antibody
abx145990-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Histidase (HAL) Antibody
abx233750-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

HAL cloning plasmid
CSB-CL010123HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1974
  • Sequence: ATGCCCAGATACACGGTGCACGTACGTGGGGAATGGCTGGCAGTGCCCTGCCAGGACGCGCAGCTCACTGTGGGCTGGCTGGGCCGGGAGGCCGTGAGGCGCTATATCAAGAATAAGCCCGACAATGGTGGCTTCACCTCCGTGGATGACGCGCACTTCCTTGTGCGCCGGTGCA
  • Show more
Description: A cloning plasmid for the HAL gene.

HAL Polyclonal Antibody
A69535 100 ?g
EUR 628.55
Description: fast delivery possible

anti- HAL antibody
FNab03750 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: histidine ammonia-lyase
  • Uniprot ID: P42357
  • Gene ID: 3034
  • Research Area: Metabolism
Description: Antibody raised against HAL

Anti-HAL antibody
PAab03750 100 ug
EUR 386

Anti-HAL antibody
STJ114988 100 µl
EUR 277
Description: Histidine ammonia-lyase is a cytosolic enzyme catalyzing the first reaction in histidine catabolism, the nonoxidative deamination of L-histidine to trans-urocanic acid. Histidine ammonia-lyase defects cause histidinemia which is characterized by increased histidine and histamine and decreased urocanic acid in body fluids. Several transcript variants encoding different isoforms have been found for this gene.

Borane Ammonia Complex
abx188628-500g 500 g
EUR 1107
  • Shipped within 1-2 weeks.

calibration solution ammonia
ISC50 ea
EUR 91

Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) ELISA kit
E01C2022-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) ELISA kit
E01C2022-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) ELISA kit
E01C2022-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carbamoyl-phosphate synthase [ammonia], mitochondrial(CPS1) ELISA kit
CSB-EL005913HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Carbamoyl-phosphate synthase [ammonia], mitochondrial (CPS1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Carbamoyl-phosphate synthase [ammonia], mitochondrial(CPS1) ELISA kit
1-CSB-EL005913HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Carbamoyl-phosphate synthase [ammonia], mitochondrial(CPS1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Carbamoyl-phosphate Synthase [ammonia], Mitochondrial (CPS1) ELISA Kit
20-abx508456
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

HAL ORF Vector (Human) (pORF)
ORF013237 1.0 ug DNA
EUR 354

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
DLR-HRG-Hu-48T 48T
EUR 517
  • Should the Human Histidine Rich Glycoprotein (HRG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Histidine Rich Glycoprotein (HRG) in samples from serum, plasma or other biological fluids.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
DLR-HRG-Hu-96T 96T
EUR 673
  • Should the Human Histidine Rich Glycoprotein (HRG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Histidine Rich Glycoprotein (HRG) in samples from serum, plasma or other biological fluids.

Human Histidine-Rich Glycoprotein, HRG ELISA Kit
DEIA254 5 plates
EUR 1361
Description: The human HRG ELISA kit is for the quantitative determination of human HRG.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
20-abx151844
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
abx251532-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human HRG(Histidine-rich glycoprotein) ELISA Kit
EH2191 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P04196
  • Alias: HRG/HPRG/HRGP/THPH11/Histidine-proline-rich glycoprotein(HPRG)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

ELISA kit for Human Histidine-rich glycoprotein
EK4461 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Histidine-rich glycoprotein in samples from serum, plasma, tissue homogenates and other biological fluids.

Human HRG/ Histidine-rich glycoprotein ELISA Kit
E1164Hu 1 Kit
EUR 571

Human Histidine- rich glycoprotein, HRG ELISA KIT
ELI-07263h 96 Tests
EUR 824

ELISA kit for Human HDC (Histidine Decarboxylase)
ELK4150 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histidine Decarboxylase (HDC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Hist
  • Show more
Description: A sandwich ELISA kit for detection of Histidine Decarboxylase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human fragile histidine triad (FHIT) ELISA Kit
CSB-E14182h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human fragile histidine triad (FHIT) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human fragile histidine triad (FHIT) ELISA Kit
1-CSB-E14182h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human fragile histidine triad (FHIT) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human histidine-rich glycoprotein (HRG) ELISA kit
CSB-E13159h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human histidine-rich glycoprotein (HRG) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human histidine-rich glycoprotein (HRG) ELISA kit
1-CSB-E13159h
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human histidine-rich glycoprotein (HRG) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
abx574921-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Fragile Histidine Triad (FHIT) ELISA Kit
abx595227-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human Fragile Histidine Triad (FHIT) ELISA Kit
abx387358-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Histidine Rich Glycoprotein(HRG)ELISA Kit
QY-E00053 96T
EUR 361

Human Histidine Rich Glycoprotein ELISA Kit (HRG)
RK01587 96 Tests
EUR 521

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
SEC534Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Rich Glycoprotein (HRG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Rich Glycoprotein (HRG) in serum, plasma and other biological fluids.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
SEC534Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Rich Glycoprotein (HRG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Rich Glycoprotein (HRG) in serum, plasma and other biological fluids.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
SEC534Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Rich Glycoprotein (HRG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Rich Glycoprotein (HRG) in serum, plasma and other biological fluids.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
SEC534Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Rich Glycoprotein (HRG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Rich Glycoprotein (HRG) in serum, plasma and other biological fluids.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
4-SEC534Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Histidine Rich Glycoprotein elisa. Alternative names of the recognized antigen: HPRG
  • HRGP
  • Histidine-Proline Rich Glycoprotein
  • Thrombophilia Due To Elevated HRG
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histidine Rich Glycoprotein (HRG) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
RDR-HRG-Hu-48Tests 48 Tests
EUR 544

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
RDR-HRG-Hu-96Tests 96 Tests
EUR 756

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
RD-HRG-Hu-48Tests 48 Tests
EUR 521

Human Histidine Rich Glycoprotein (HRG) ELISA Kit
RD-HRG-Hu-96Tests 96 Tests
EUR 723

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
DLR-CSE-Hu-48T 48T
EUR 498
  • Should the Human Cystathionine Gamma Lyase (CSE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystathionine Gamma Lyase (CSE) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
DLR-CSE-Hu-96T 96T
EUR 647
  • Should the Human Cystathionine Gamma Lyase (CSE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cystathionine Gamma Lyase (CSE) in samples from tissue homogenates, cell lysates or other biological fluids.

Human N acetylneuraminate lyase(NPL) ELISA kit
E01N0555-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acetylneuraminate lyase(NPL) ELISA kit
E01N0555-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acetylneuraminate lyase(NPL) ELISA kit
E01N0555-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CTH/ Cystathionine gamma-lyase ELISA Kit
E0590Hu 1 Kit
EUR 571

Human Cystathionine gamma Lyase (CSE) ELISA Kit
20-abx151193
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Cystathionine gamma-lyase (CTH) ELISA Kit
abx251107-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Cystathionine gamma-lyase
EK3769 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cystathionine gamma-lyase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CTH(Cystathionine gamma-lyase) ELISA Kit
EH1799 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: P32929
  • Alias: CTH/Cystathionine gamma-lyase/Gamma-cystathionase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human N- acetylneuraminate lyase, NPL ELISA KIT
ELI-21267h 96 Tests
EUR 824

Human Cystathionine gamma- lyase, CTH ELISA KIT
ELI-05064h 96 Tests
EUR 824

Human Cystathionine gamma-lyase(CTH) ELISA kit
CSB-EL006160HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Cystathionine gamma-lyase (CTH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Cystathionine gamma-lyase(CTH) ELISA kit
1-CSB-EL006160HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Cystathionine gamma-lyase(CTH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human N-acetylneuraminate lyase (NPL) ELISA Kit
abx381863-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human cystathionine-γ-lyase(CSE)ELISA Kit
GA-E0741HM-48T 48T
EUR 289

Human cystathionine-γ-lyase(CSE)ELISA Kit
GA-E0741HM-96T 96T
EUR 466

Human cystathionine-γ-lyase(CSE)ELISA Kit
QY-E00985 96T
EUR 361

Human Cystathionine Gamma Lyase ELISA Kit (CSE)
RK01192 96 Tests
EUR 521

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
RDR-CSE-Hu-48Tests 48 Tests
EUR 522

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
RDR-CSE-Hu-96Tests 96 Tests
EUR 724

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
SEB538Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystathionine Gamma Lyase (CSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystathionine Gamma Lyase (CSE) in tissue homogenates, cell lysates and other biological fluids.

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
SEB538Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystathionine Gamma Lyase (CSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystathionine Gamma Lyase (CSE) in tissue homogenates, cell lysates and other biological fluids.

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
SEB538Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystathionine Gamma Lyase (CSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystathionine Gamma Lyase (CSE) in tissue homogenates, cell lysates and other biological fluids.

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
SEB538Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystathionine Gamma Lyase (CSE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystathionine Gamma Lyase (CSE) in tissue homogenates, cell lysates and other biological fluids.

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
4-SEB538Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cystathionine Gamma Lyase elisa. Alternative names of the recognized antigen: CTH
  • Cystathionase
  • Cysteine-protein sulfhydrase
  • Gamma-cystathionase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cystathionine Gamma Lyase (CSE) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
RD-CSE-Hu-48Tests 48 Tests
EUR 500

Human Cystathionine Gamma Lyase (CSE) ELISA Kit
RD-CSE-Hu-96Tests 96 Tests
EUR 692

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Rat 2-oxo-histidine ELISA kit
E02O0854-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human HAL(Histidine Ammonia Lyase) ELISA Kit