Human DBI(Diazepam Binding Inhibitor) ELISA Kit

Human DBI(Diazepam Binding Inhibitor) ELISA Kit

Human Diazepam Binding Inhibitor (DBI) ELISA Kit
RD-DBI-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Diazepam Binding Inhibitor (DBI) ELISA Kit
RD-DBI-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit
DLR-DBI-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Diazepam Binding Inhibitor (DBI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit
DLR-DBI-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Diazepam Binding Inhibitor (DBI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit
RDR-DBI-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit
RDR-DBI-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit
RD-DBI-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit
RD-DBI-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Diazepam Binding Inhibitor (DBI) ELISA Kit
20-abx151259	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Diazepam Binding Inhibitor ELISA Kit (DBI)
RK01247	Abclonal	96 Tests	EUR 521

Human Diazepam Binding Inhibitor(DBI)ELISA Kit
QY-E04349	Qayee Biotechnology	96T	EUR 361

Human Diazepam Binding Inhibitor (DBI) ELISA Kit
SED696Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diazepam Binding Inhibitor (DBI) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Diazepam Binding Inhibitor (DBI) ELISA Kit
SED696Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diazepam Binding Inhibitor (DBI) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Diazepam Binding Inhibitor (DBI) ELISA Kit
SED696Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diazepam Binding Inhibitor (DBI) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Diazepam Binding Inhibitor (DBI) ELISA Kit
SED696Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diazepam Binding Inhibitor (DBI) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Diazepam Binding Inhibitor (DBI) ELISA Kit
4-SED696Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Diazepam Binding Inhibitor elisa. Alternative names of the recognized antigen: ACBP ACBD1 CCK-RP EP Endozepine GABA Receptor Modulator Acyl-Coenzyme A Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Diazepam Binding Inhibitor (DBI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Diazepam Binding Inhibitor (DBI) Antibody
20-abx112062	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody
20-abx109495	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody
20-abx121589	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody
20-abx102549	Abbexa	EUR 314.00 EUR 133.00 EUR 815.00 EUR 425.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Diazepam Binding Inhibitor (DBI) Antibody
20-abx102550	Abbexa	EUR 314.00 EUR 133.00 EUR 829.00 EUR 439.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Diazepam Binding Inhibitor (DBI) Antibody
20-abx004111	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody
20-abx172112	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Diazepam Binding Inhibitor (DBI) Antibody
20-abx176163	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Diazepam Binding Inhibitor (DBI) Antibody
20-abx324416	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody
20-abx327436	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody
abx232256-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Diazepam Binding Inhibitor (DBI)
4-RPD696Hu01	Cloud-Clone	EUR 315.04 EUR 187.00 EUR 906.40 EUR 368.80 EUR 637.60 EUR 274.00 EUR 2116.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P07108 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.8kDa Isoelectric Point: Inquire
Description: Recombinant Human Diazepam Binding Inhibitor expressed in: E.coli

Recombinant Diazepam Binding Inhibitor (DBI)
4-RPD696Mu01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P31786 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 11.4kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Diazepam Binding Inhibitor expressed in: E.coli

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit
20-abx153899	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Diazepam Binding Inhibitor ELISA Kit (DBI)
RK02739	Abclonal	96 Tests	EUR 521

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit
SED696Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diazepam Binding Inhibitor (DBI) in serum, plasma and other biological fluids.

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit
SED696Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diazepam Binding Inhibitor (DBI) in serum, plasma and other biological fluids.

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit
SED696Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diazepam Binding Inhibitor (DBI) in serum, plasma and other biological fluids.

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit
SED696Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diazepam Binding Inhibitor (DBI) in serum, plasma and other biological fluids.

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit
4-SED696Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Diazepam Binding Inhibitor elisa. Alternative names of the recognized antigen: ACBP ACBD1 CCK-RP EP Endozepine GABA Receptor Modulator Acyl-Coenzyme A Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Diazepam Binding Inhibitor (DBI) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Diazepam Binding Inhibitor (DBI) Fragment (human)
H-6760.0001	Bachem	1.0mg	EUR 225
Description: Sum Formula: C91H148N26O32S; CAS# [104360-70-5]

Diazepam Binding Inhibitor (DBI) Fragment (human)
H-6760.0005	Bachem	5.0mg	EUR 803
Description: Sum Formula: C91H148N26O32S; CAS# [104360-70-5]

Human Diazepam Binding Inhibitor (DBI) Protein
20-abx066328	Abbexa	EUR 453.00 EUR 230.00 EUR 1233.00 EUR 523.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Diazepam Binding Inhibitor (DBI) CLIA Kit
20-abx494355	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human DBI (Diazepam Binding Inhibitor)
ELK4965	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diazepam Binding Inhibitor (DBI). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to D Show more
Description: A sandwich ELISA kit for detection of Diazepam Binding Inhibitor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Diazepam Binding Inhibitor (DBI) Protein
20-abx066329	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Diazepam Binding Inhibitor (DBI) Antibody (Biotin)
20-abx105096	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody (FITC)
20-abx106513	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody (HRP)
20-abx107930	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody (FITC)
20-abx273600	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Diazepam Binding Inhibitor (DBI) Antibody Pair
20-abx370082	Abbexa	EUR 1748.00 EUR 1121.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Diazepam Binding Inhibitor (DBI) Antibody (Biotin)
20-abx272338	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Diazepam Binding Inhibitor (DBI) Antibody (Biotin)
20-abx272839	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Anti-Diazepam Binding Inhibitor/DBI Antibody
A01267	BosterBio	100ug/vial	EUR 334

Mouse Diazepam Binding Inhibitor (DBI) CLIA Kit
20-abx494356	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Mouse DBI (Diazepam Binding Inhibitor)
ELK7300	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diazepam Binding Inhibitor (DBI). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to D Show more
Description: A sandwich ELISA kit for detection of Diazepam Binding Inhibitor from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

DBI Diazepam Binding Inhibitor Human Recombinant Protein
PROTP07108	BosterBio	Regular: 25ug	EUR 317
Description: DBI Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 107 amino acids (1-87a.a.) and having a molecular mass of 12.2kDa. DBI protein is fused to a 20 amino acid His tag at N-terminus and is purified by standard chromatography.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse)
4-PAD696Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Met1~Ile87) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI)

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat)
4-PAD696Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Ser2~Ile87) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI)

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse), APC
4-PAD696Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Met1~Ile87) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI). This antibody is labeled with APC.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAD696Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Met1~Ile87) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI). This antibody is labeled with Biotin.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse), Cy3
4-PAD696Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Met1~Ile87) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI). This antibody is labeled with Cy3.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse), FITC
4-PAD696Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Met1~Ile87) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI). This antibody is labeled with FITC.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse), HRP
4-PAD696Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Met1~Ile87) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI). This antibody is labeled with HRP.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse), PE
4-PAD696Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Met1~Ile87) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI). This antibody is labeled with PE.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat), APC
4-PAD696Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Ser2~Ile87) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI). This antibody is labeled with APC.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAD696Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Ser2~Ile87) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI). This antibody is labeled with Biotin.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAD696Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Ser2~Ile87) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI). This antibody is labeled with Cy3.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat), FITC
4-PAD696Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Ser2~Ile87) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI). This antibody is labeled with FITC.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat), HRP
4-PAD696Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Ser2~Ile87) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI). This antibody is labeled with HRP.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat), PE
4-PAD696Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Ser2~Ile87) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI). This antibody is labeled with PE.

Diazepam Binding Inhibitor, Human
LF-P0046	Abfrontier	0.5 mg	EUR 202
Description: Diazepam Binding Inhibitor, Human protein

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAD696Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Met1~Ile87) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI). This antibody is labeled with APC-Cy7.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAD696Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DBI (Ser2~Ile87) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI). This antibody is labeled with APC-Cy7.

Diazepam Binding Inhibitor Protein
20-abx260602	Abbexa	EUR 2861.00 EUR 328.00 EUR 230.00	1 mg 25 ug 5 ug
Shipped within 5-10 working days.

Diazepam Binding Inhibitor protein
30R-3011	Fitzgerald	500 ug	EUR 224
Description: Purified recombinant Diazepam Binding Inhibitor protein

Diazepam Binding Inhibitor antibody
20R-2924	Fitzgerald	100 ul	EUR 393
Description: Rabbit polyclonal Diazepam Binding Inhibitor antibody

anti-Diazepam Binding Inhibitor
LF-PA0079	Abfrontier	100 ul	EUR 334
Description: Rabbit polyclonal to Diazepam Binding Inhibitor

anti-Diazepam Binding Inhibitor
YF-PA11288	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Diazepam Binding Inhibitor

anti-Diazepam Binding Inhibitor
YF-PA23569	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Diazepam Binding Inhibitor

Diazepam-Binding Inhibitor Fragment, human
5-01044	CHI Scientific	4 x 1mg	Ask for price

Human Diazepam Binding Inhibitor Antibody
32991-05111	AssayPro	150 ug	EUR 261

Recombinant Human Diazepam Binding Inhibitor
7-04960	CHI Scientific	5µg	Ask for price

Recombinant Human Diazepam Binding Inhibitor
7-04961	CHI Scientific	25µg	Ask for price

Recombinant Human Diazepam Binding Inhibitor
7-04962	CHI Scientific	1mg	Ask for price

Mouse Diazepam Binding Inhibitor Antibody
33372-05111	AssayPro	150 ug	EUR 261

anti-Diazepam Binding Inhibitor (20B10)
LF-MA0076	Abfrontier	100 ul	EUR 334
Description: Mouse monoclonal to Deazepam Binding Inhibitor

anti-Diazepam Binding Inhibitor (27C9)
LF-MA0081	Abfrontier	100 ul	EUR 334
Description: Mouse monoclonal to Deazepam Binding Inhibitor

Human Diazepam Binding Inhibitor Antibody (Biotin Conjugate)
32991-05121	AssayPro	150 ug	EUR 369

Bovine Diazepam- binding inhibitor- like 5, DBIL5 ELISA KIT
ELI-28130b	Lifescience Market	96 Tests	EUR 928

Mouse Diazepam- binding inhibitor- like 5, Dbil5 ELISA KIT
ELI-46695m	Lifescience Market	96 Tests	EUR 865

Human Diazepam Binding Inhibitor AssayLite Antibody (FITC Conjugate)
32991-05141	AssayPro	150 ug	EUR 428

Human Diazepam Binding Inhibitor AssayLite Antibody (RPE Conjugate)
32991-05151	AssayPro	150 ug	EUR 428

Human Diazepam Binding Inhibitor AssayLite Antibody (APC Conjugate)
32991-05161	AssayPro	150 ug	EUR 428

Human Diazepam Binding Inhibitor AssayLite Antibody (PerCP Conjugate)
32991-05171	AssayPro	150 ug	EUR 471

Mouse Diazepam Binding Inhibitor Antibody (Biotin Conjugate)
33372-05121	AssayPro	150 ug	EUR 369

Mouse Diazepam-binding inhibitor-like 5 (Dbil5)
1-CSB-EP520959MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 13.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Diazepam-binding inhibitor-like 5(Dbil5) expressed in E.coli

Human Diazepam Binding Inhibitor AssayLite RPE-Conjugated Antibody ICC Kit
ICC32991R	AssayPro	Kit	EUR 406

Mouse Diazepam Binding Inhibitor AssayLite Antibody (FITC Conjugate)
33372-05141	AssayPro	150 ug	EUR 428

Mouse Diazepam Binding Inhibitor AssayLite Antibody (RPE Conjugate)
33372-05151	AssayPro	150 ug	EUR 428

Mouse Diazepam Binding Inhibitor AssayLite Antibody (APC Conjugate)
33372-05161	AssayPro	150 ug	EUR 428

Mouse Diazepam Binding Inhibitor AssayLite Antibody (PerCP Conjugate)
33372-05171	AssayPro	150 ug	EUR 471

Dbi/ Rat Dbi ELISA Kit
ELI-49488r	Lifescience Market	96 Tests	EUR 886

Diazepam ELISA Kit
DEIA053	Creative Diagnostics	96T	EUR 1032
Description: The Diazepam ELISA Test Kit is a competitive enzyme immunoassay for the quantitative analysis of Diazepam in tissue, feed and urine.

Human Diazepam Binding Inhibitor AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit
FACS32991M	AssayPro	Kit	EUR 693

Human Acyl-CoA-binding protein(DBI) ELISA kit
E01A1824-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyl-CoA-binding protein(DBI) ELISA kit
E01A1824-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyl-CoA-binding protein(DBI) ELISA kit
E01A1824-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyl- CoA- binding protein, DBI ELISA KIT
ELI-49886h	Lifescience Market	96 Tests	EUR 824

DBI ELISA kit
55R-1872	Fitzgerald	1 kit	EUR 743
Description: ELISA kit for the detection of DBI in the research laboratory

Diazepam (DZP) ELISA Kit
abx364897-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Goat Acyl-CoA-binding protein(DBI) ELISA kit
E06A1824-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acyl-CoA-binding protein(DBI) ELISA kit
E06A1824-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acyl-CoA-binding protein(DBI) ELISA kit
E06A1824-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acyl-CoA-binding protein(DBI) ELISA kit
E03A1824-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acyl-CoA-binding protein(DBI) ELISA kit
E03A1824-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acyl-CoA-binding protein(DBI) ELISA kit
E03A1824-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acyl-CoA-binding protein(DBI) ELISA kit
E04A1824-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acyl-CoA-binding protein(DBI) ELISA kit
E04A1824-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acyl-CoA-binding protein(DBI) ELISA kit
E04A1824-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acyl-CoA-binding protein(DBI) ELISA kit
E02A1824-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acyl-CoA-binding protein(DBI) ELISA kit
E02A1824-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acyl-CoA-binding protein(DBI) ELISA kit
E02A1824-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acyl-CoA-binding protein(DBI) ELISA kit
E07A1824-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acyl-CoA-binding protein(DBI) ELISA kit
E07A1824-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acyl-CoA-binding protein(DBI) ELISA kit
E07A1824-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acyl-CoA-binding protein(DBI) ELISA kit
E09A1824-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acyl-CoA-binding protein(DBI) ELISA kit
E09A1824-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acyl-CoA-binding protein(DBI) ELISA kit
E09A1824-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acyl-CoA-binding protein(DBI) ELISA kit
E08A1824-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acyl-CoA-binding protein(DBI) ELISA kit
E08A1824-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acyl-CoA-binding protein(DBI) ELISA kit
E08A1824-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acyl- CoA- binding protein, DBI ELISA KIT
ELI-11875Ra	Lifescience Market	96 Tests	EUR 928

Chicken Acyl- CoA- binding protein, DBI ELISA KIT
ELI-12062c	Lifescience Market	96 Tests	EUR 928

Bovine Acyl- CoA- binding protein, DBI ELISA KIT
ELI-35085b	Lifescience Market	96 Tests	EUR 928

Mouse Acyl- CoA- binding protein, Dbi ELISA KIT
ELI-35108m	Lifescience Market	96 Tests	EUR 865

Porcine Acyl- CoA- binding protein, DBI ELISA KIT
ELI-49887p	Lifescience Market	96 Tests	EUR 928

Rat Acyl-CoA-Binding Protein (DBI) ELISA Kit
abx391221-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Acyl-CoA-binding protein (DBI)
1-CSB-EP006519HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 15.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Acyl-CoA-binding protein(DBI) expressed in E.coli

Human DBI (ACBP) ELISA kit
LF-EK0116	Abfrontier	1×96T	EUR 603

DBI ELISA Kit (Human) (OKCD00917)
OKCD00917	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Binds medium- and long-chain acyl-CoA esters with very high affinity and may function as an intracellular carrier of acyl-CoA esters. It is also able to displace diazepam from the benzodiazepine (BZD) recognition site located on the GABA type A receptor. It is therefore possible that this protein also acts as a neuropeptide to modulate the action of the GABA receptor. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.127 ng/mL

DBI ELISA Kit (Human) (OKAN06390)
OKAN06390	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.127 ng/mL

Diazepam
AG109	Unibiotest	1 mg	EUR 523

Diazepam
AT109	Unibiotest	1mg	EUR 1368

Dbi ELISA Kit| Rat Acyl-CoA-binding protein ELISA Kit
EF018575	Lifescience Market	96 Tests	EUR 689

Dbi ELISA Kit| Mouse Acyl-CoA-binding protein ELISA Kit
EF014687	Lifescience Market	96 Tests	EUR 689

DBI ELISA Kit| chicken Acyl-CoA-binding protein ELISA Kit
EF012281	Lifescience Market	96 Tests	EUR 689

DBI ELISA Kit| Bovine Acyl-CoA-binding protein ELISA Kit
EF011315	Lifescience Market	96 Tests	EUR 689

Canine DBI ELISA KIT
ELI-49447d	Lifescience Market	96 Tests	EUR 928

Guinea pig Acyl-CoA-binding protein(DBI) ELISA kit
E05A1824-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Acyl-CoA-binding protein(DBI) ELISA kit
E05A1824-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Acyl-CoA-binding protein(DBI) ELISA kit
E05A1824-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Inhibitor k Binding ELISA kit
E01I0025-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Inhibitor k Binding ELISA kit
E01I0025-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Inhibitor k Binding ELISA kit
E01I0025-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DBI (ACBP) ELISA kit (4X96T)
LF-EK0117	Abfrontier	4×96T	EUR 2045

Human DBI (ACBP) ELISA kit (10X96T)
LF-EK0118	Abfrontier	10×96T	EUR 4484

Mouse Acyl-CoA-binding protein (Dbi)
1-CSB-EP006519MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 16.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Acyl-CoA-binding protein(Dbi) expressed in E.coli

Rat Acyl-CoA-binding protein (Dbi)
1-CSB-EP006519RA	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 16.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Acyl-CoA-binding protein(Dbi) expressed in E.coli

Diazepam antibody
20-1238	Fitzgerald	100 ul	EUR 657
Description: Sheep polyclonal Diazepam antibody

Diazepam [HRP]
DAGA-081H	Creative Diagnostics	1mg	EUR 1170

Diazepam [BSA]
DAGA-093B	Creative Diagnostics	1mg	EUR 780

Diazepam [KLH]
DAGA-099K	Creative Diagnostics	1mg	EUR 1040

DBI ELISA Kit (Mouse) (OKCD00402)
OKCD00402	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Binds medium- and long-chain acyl-CoA esters with very high affinity and may function as an intracellular carrier of acyl-CoA esters. It is also able to displace diazepam from the benzodiazepine (BZD) recognition site located on the GABA type A receptor. It is therefore possible that this protein also acts as a neuropeptide to modulate the action of the GABA receptor. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 2.67 ng/mL

DBI ELISA Kit (Mouse) (OKAN06448)
OKAN06448	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.065 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Goat Inhibitor k Binding ELISA kit
E06I0025-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Inhibitor k Binding ELISA kit
E06I0025-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Inhibitor k Binding ELISA kit
E06I0025-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Inhibitor k Binding ELISA kit
E02I0025-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Inhibitor k Binding ELISA kit
E02I0025-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Inhibitor k Binding ELISA kit
E02I0025-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Inhibitor k Binding ELISA kit
E03I0025-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Inhibitor k Binding ELISA kit
E03I0025-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Inhibitor k Binding ELISA kit
E03I0025-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Inhibitor k Binding ELISA kit
E04I0025-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Inhibitor k Binding ELISA kit
E04I0025-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Inhibitor k Binding ELISA kit
E04I0025-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Inhibitor k Binding ELISA kit
E08I0025-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Inhibitor k Binding ELISA kit
E08I0025-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Inhibitor k Binding ELISA kit
E08I0025-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Inhibitor k Binding ELISA kit
E07I0025-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Inhibitor k Binding ELISA kit
E07I0025-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Inhibitor k Binding ELISA kit
E07I0025-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Inhibitor k Binding ELISA kit
E09I0025-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Inhibitor k Binding ELISA kit
E09I0025-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Inhibitor k Binding ELISA kit
E09I0025-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

DBI siRNA
20-abx901415	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DBI siRNA
20-abx913599	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DBI siRNA
20-abx913600	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DBI antibody
70R-2557	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DBI antibody

DBI Antibody
ABD7307	Lifescience Market	100 ug	EUR 438

DBI antibody
10R-7489	Fitzgerald	100 ul	EUR 393
Description: Mouse monoclonal DBI antibody

DBI antibody
10R-7490	Fitzgerald	100 ul	EUR 393
Description: Mouse monoclonal DBI antibody

DBI Antibody
32810-100ul	SAB	100ul	EUR 252

DBI antibody
70R-16747	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DBI antibody

DBI Antibody
DF7307	Affbiotech	200ul	EUR 304
Description: DBI Antibody detects endogenous levels of total DBI.

DBI Antibody
1-CSB-PA000798	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DBI. Recognizes DBI from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

DBI Antibody
1-CSB-PA005119	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DBI. Recognizes DBI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

DBI Antibody
1-CSB-PA006519GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DBI. Recognizes DBI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DBI Antibody
1-CSB-PA006519HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DBI. Recognizes DBI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Guinea pig Inhibitor k Binding ELISA kit
E05I0025-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Inhibitor k Binding ELISA kit
E05I0025-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Inhibitor k Binding ELISA kit
E05I0025-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DBI shRNA Plasmid
20-abx951143	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DBI Recombinant Protein (Human)
RP008779	ABM	100 ug	Ask for price

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

DBI Conjugated Antibody
C32810	SAB	100ul	EUR 397

DBI cloning plasmid
CSB-CL006519HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 315 Sequence: atgtggggcgacctctggctcctcccgcctgcctctgccaatccgggcactgggacagaggctgagtttgagaaagctgcagaggaggttaggcaccttaagaccaagccatcggatgaggagatgctgttcatctatggccactacaaacaagcaactgtgggcgacataaatac Show more
Description: A cloning plasmid for the DBI gene.

anti- DBI antibody
FNab02256	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein) Uniprot ID: P07108 Gene ID: 1622 Research Area: Metabolism
Description: Antibody raised against DBI

DBI Blocking Peptide
20-abx162385	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Human DBI(Diazepam Binding Inhibitor) ELISA Kit