Skip to content
Theragen Bio

Research Data

  • Home
  • Western Blot Reagents
  • Body’s bugs to be sequenced
  • Our products
  • Home
  • Western Blot Reagents
  • Body’s bugs to be sequenced
  • Our products

Human DBI(Diazepam Binding Inhibitor) ELISA Kit

  • Home
  • Human DBI(Diazepam Binding Inhibitor) ELISA Kit

Human DBI(Diazepam Binding Inhibitor) ELISA Kit

Human Diazepam Binding Inhibitor (DBI) ELISA Kit

RD-DBI-Hu-48Tests Reddot Biotech 48 Tests
EUR 521

Human Diazepam Binding Inhibitor (DBI) ELISA Kit

RD-DBI-Hu-96Tests Reddot Biotech 96 Tests
EUR 723

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit

DLR-DBI-Mu-48T DL Develop 48T
EUR 527
  • Should the Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Diazepam Binding Inhibitor (DBI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit

DLR-DBI-Mu-96T DL Develop 96T
EUR 688
  • Should the Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Diazepam Binding Inhibitor (DBI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit

RDR-DBI-Mu-48Tests Reddot Biotech 48 Tests
EUR 557

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit

RDR-DBI-Mu-96Tests Reddot Biotech 96 Tests
EUR 774

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit

RD-DBI-Mu-48Tests Reddot Biotech 48 Tests
EUR 533

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit

RD-DBI-Mu-96Tests Reddot Biotech 96 Tests
EUR 740

Human Diazepam Binding Inhibitor (DBI) ELISA Kit

20-abx151259 Abbexa
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Diazepam Binding Inhibitor ELISA Kit (DBI)

RK01247 Abclonal 96 Tests
EUR 521

Human Diazepam Binding Inhibitor(DBI)ELISA Kit

QY-E04349 Qayee Biotechnology 96T
EUR 361

Human Diazepam Binding Inhibitor (DBI) ELISA Kit

SED696Hu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diazepam Binding Inhibitor (DBI) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Diazepam Binding Inhibitor (DBI) ELISA Kit

SED696Hu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diazepam Binding Inhibitor (DBI) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Diazepam Binding Inhibitor (DBI) ELISA Kit

SED696Hu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diazepam Binding Inhibitor (DBI) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Diazepam Binding Inhibitor (DBI) ELISA Kit

SED696Hu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diazepam Binding Inhibitor (DBI) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Diazepam Binding Inhibitor (DBI) ELISA Kit

4-SED696Hu Cloud-Clone
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diazepam Binding Inhibitor elisa. Alternative names of the recognized antigen: ACBP
  • ACBD1
  • CCK-RP
  • EP
  • Endozepine
  • GABA Receptor Modulator
  • Acyl-Coenzyme A Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Diazepam Binding Inhibitor (DBI) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Diazepam Binding Inhibitor (DBI) Antibody

20-abx112062 Abbexa
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody

20-abx109495 Abbexa
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody

20-abx121589 Abbexa
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody

20-abx102549 Abbexa
  • EUR 314.00
  • EUR 133.00
  • EUR 815.00
  • EUR 425.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Diazepam Binding Inhibitor (DBI) Antibody

20-abx102550 Abbexa
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Diazepam Binding Inhibitor (DBI) Antibody

20-abx004111 Abbexa
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody

20-abx172112 Abbexa
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Diazepam Binding Inhibitor (DBI) Antibody

20-abx176163 Abbexa
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Diazepam Binding Inhibitor (DBI) Antibody

20-abx324416 Abbexa
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody

20-abx327436 Abbexa
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody

abx232256-100ug Abbexa 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Diazepam Binding Inhibitor (DBI)

4-RPD696Hu01 Cloud-Clone
  • EUR 315.04
  • EUR 187.00
  • EUR 906.40
  • EUR 368.80
  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07108
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Diazepam Binding Inhibitor expressed in: E.coli

Recombinant Diazepam Binding Inhibitor (DBI)

4-RPD696Mu01 Cloud-Clone
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P31786
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 11.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Diazepam Binding Inhibitor expressed in: E.coli

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit

20-abx153899 Abbexa
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Diazepam Binding Inhibitor ELISA Kit (DBI)

RK02739 Abclonal 96 Tests
EUR 521

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit

SED696Mu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diazepam Binding Inhibitor (DBI) in serum, plasma and other biological fluids.

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit

SED696Mu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diazepam Binding Inhibitor (DBI) in serum, plasma and other biological fluids.

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit

SED696Mu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diazepam Binding Inhibitor (DBI) in serum, plasma and other biological fluids.

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit

SED696Mu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Diazepam Binding Inhibitor (DBI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Diazepam Binding Inhibitor (DBI) in serum, plasma and other biological fluids.

Mouse Diazepam Binding Inhibitor (DBI) ELISA Kit

4-SED696Mu Cloud-Clone
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diazepam Binding Inhibitor elisa. Alternative names of the recognized antigen: ACBP
  • ACBD1
  • CCK-RP
  • EP
  • Endozepine
  • GABA Receptor Modulator
  • Acyl-Coenzyme A Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Diazepam Binding Inhibitor (DBI) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Diazepam Binding Inhibitor (DBI) Fragment (human)

H-6760.0001 Bachem 1.0mg
EUR 225
Description: Sum Formula: C91H148N26O32S; CAS# [104360-70-5]

Diazepam Binding Inhibitor (DBI) Fragment (human)

H-6760.0005 Bachem 5.0mg
EUR 803
Description: Sum Formula: C91H148N26O32S; CAS# [104360-70-5]

Human Diazepam Binding Inhibitor (DBI) Protein

20-abx066328 Abbexa
  • EUR 453.00
  • EUR 230.00
  • EUR 1233.00
  • EUR 523.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Diazepam Binding Inhibitor (DBI) CLIA Kit

20-abx494355 Abbexa
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human DBI (Diazepam Binding Inhibitor)

ELK4965 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diazepam Binding Inhibitor (DBI). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to D
  • Show more
Description: A sandwich ELISA kit for detection of Diazepam Binding Inhibitor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Diazepam Binding Inhibitor (DBI) Protein

20-abx066329 Abbexa
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Diazepam Binding Inhibitor (DBI) Antibody (Biotin)

20-abx105096 Abbexa
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody (FITC)

20-abx106513 Abbexa
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody (HRP)

20-abx107930 Abbexa
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Diazepam Binding Inhibitor (DBI) Antibody (FITC)

20-abx273600 Abbexa
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Diazepam Binding Inhibitor (DBI) Antibody Pair

20-abx370082 Abbexa
  • EUR 1748.00
  • EUR 1121.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Diazepam Binding Inhibitor (DBI) Antibody (Biotin)

20-abx272338 Abbexa
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Diazepam Binding Inhibitor (DBI) Antibody (Biotin)

20-abx272839 Abbexa
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Anti-Diazepam Binding Inhibitor/DBI Antibody

A01267 BosterBio 100ug/vial
EUR 334

Mouse Diazepam Binding Inhibitor (DBI) CLIA Kit

20-abx494356 Abbexa
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Mouse DBI (Diazepam Binding Inhibitor)

ELK7300 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diazepam Binding Inhibitor (DBI). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to D
  • Show more
Description: A sandwich ELISA kit for detection of Diazepam Binding Inhibitor from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

DBI Diazepam Binding Inhibitor Human Recombinant Protein

PROTP07108 BosterBio Regular: 25ug
EUR 317
Description: DBI Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 107 amino acids (1-87a.a.) and having a molecular mass of 12.2kDa. DBI protein is fused to a 20 amino acid His tag at N-terminus and is purified by standard chromatography.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse)

4-PAD696Hu01 Cloud-Clone
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Met1~Ile87)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI)

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat)

4-PAD696Mu01 Cloud-Clone
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Ser2~Ile87)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI)

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse), APC

4-PAD696Hu01-APC Cloud-Clone
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Met1~Ile87)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI). This antibody is labeled with APC.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAD696Hu01-Biotin Cloud-Clone
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Met1~Ile87)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI). This antibody is labeled with Biotin.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse), Cy3

4-PAD696Hu01-Cy3 Cloud-Clone
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Met1~Ile87)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI). This antibody is labeled with Cy3.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse), FITC

4-PAD696Hu01-FITC Cloud-Clone
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Met1~Ile87)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI). This antibody is labeled with FITC.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse), HRP

4-PAD696Hu01-HRP Cloud-Clone
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Met1~Ile87)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI). This antibody is labeled with HRP.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse), PE

4-PAD696Hu01-PE Cloud-Clone
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Met1~Ile87)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI). This antibody is labeled with PE.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat), APC

4-PAD696Mu01-APC Cloud-Clone
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Ser2~Ile87)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI). This antibody is labeled with APC.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat), Biotinylated

4-PAD696Mu01-Biotin Cloud-Clone
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Ser2~Ile87)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI). This antibody is labeled with Biotin.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat), Cy3

4-PAD696Mu01-Cy3 Cloud-Clone
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Ser2~Ile87)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI). This antibody is labeled with Cy3.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat), FITC

4-PAD696Mu01-FITC Cloud-Clone
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Ser2~Ile87)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI). This antibody is labeled with FITC.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat), HRP

4-PAD696Mu01-HRP Cloud-Clone
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Ser2~Ile87)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI). This antibody is labeled with HRP.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat), PE

4-PAD696Mu01-PE Cloud-Clone
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Ser2~Ile87)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI). This antibody is labeled with PE.

Diazepam Binding Inhibitor, Human

LF-P0046 Abfrontier 0.5 mg
EUR 202
Description: Diazepam Binding Inhibitor, Human protein

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAD696Hu01-APC-Cy7 Cloud-Clone
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Met1~Ile87)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Diazepam Binding Inhibitor (DBI). This antibody is labeled with APC-Cy7.

Diazepam Binding Inhibitor (DBI) Polyclonal Antibody (Mouse, Rat), APC-Cy7

4-PAD696Mu01-APC-Cy7 Cloud-Clone
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBI (Ser2~Ile87)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Diazepam Binding Inhibitor (DBI). This antibody is labeled with APC-Cy7.

Diazepam Binding Inhibitor Protein

20-abx260602 Abbexa
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

Diazepam Binding Inhibitor protein

30R-3011 Fitzgerald 500 ug
EUR 224
Description: Purified recombinant Diazepam Binding Inhibitor protein

Diazepam Binding Inhibitor antibody

20R-2924 Fitzgerald 100 ul
EUR 393
Description: Rabbit polyclonal Diazepam Binding Inhibitor antibody

anti-Diazepam Binding Inhibitor

LF-PA0079 Abfrontier 100 ul
EUR 334
Description: Rabbit polyclonal to Diazepam Binding Inhibitor

anti-Diazepam Binding Inhibitor

YF-PA11288 Abfrontier 100 ug
EUR 403
Description: Rabbit polyclonal to Diazepam Binding Inhibitor

anti-Diazepam Binding Inhibitor

YF-PA23569 Abfrontier 50 ul
EUR 334
Description: Mouse polyclonal to Diazepam Binding Inhibitor

Diazepam-Binding Inhibitor Fragment, human

5-01044 CHI Scientific 4 x 1mg Ask for price

Human Diazepam Binding Inhibitor Antibody

32991-05111 AssayPro 150 ug
EUR 261

Recombinant Human Diazepam Binding Inhibitor

7-04960 CHI Scientific 5µg Ask for price

Recombinant Human Diazepam Binding Inhibitor

7-04961 CHI Scientific 25µg Ask for price

Recombinant Human Diazepam Binding Inhibitor

7-04962 CHI Scientific 1mg Ask for price

Mouse Diazepam Binding Inhibitor Antibody

33372-05111 AssayPro 150 ug
EUR 261

anti-Diazepam Binding Inhibitor (20B10)

LF-MA0076 Abfrontier 100 ul
EUR 334
Description: Mouse monoclonal to Deazepam Binding Inhibitor

anti-Diazepam Binding Inhibitor (27C9)

LF-MA0081 Abfrontier 100 ul
EUR 334
Description: Mouse monoclonal to Deazepam Binding Inhibitor

Human Diazepam Binding Inhibitor Antibody (Biotin Conjugate)

32991-05121 AssayPro 150 ug
EUR 369

Bovine Diazepam- binding inhibitor- like 5, DBIL5 ELISA KIT

ELI-28130b Lifescience Market 96 Tests
EUR 928

Mouse Diazepam- binding inhibitor- like 5, Dbil5 ELISA KIT

ELI-46695m Lifescience Market 96 Tests
EUR 865

Human Diazepam Binding Inhibitor AssayLite Antibody (FITC Conjugate)

32991-05141 AssayPro 150 ug
EUR 428

Human Diazepam Binding Inhibitor AssayLite Antibody (RPE Conjugate)

32991-05151 AssayPro 150 ug
EUR 428

Human Diazepam Binding Inhibitor AssayLite Antibody (APC Conjugate)

32991-05161 AssayPro 150 ug
EUR 428

Human Diazepam Binding Inhibitor AssayLite Antibody (PerCP Conjugate)

32991-05171 AssayPro 150 ug
EUR 471

Mouse Diazepam Binding Inhibitor Antibody (Biotin Conjugate)

33372-05121 AssayPro 150 ug
EUR 369

Mouse Diazepam-binding inhibitor-like 5 (Dbil5)

1-CSB-EP520959MO Cusabio
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 13.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Diazepam-binding inhibitor-like 5(Dbil5) expressed in E.coli

Human Diazepam Binding Inhibitor AssayLite RPE-Conjugated Antibody ICC Kit

ICC32991R AssayPro Kit
EUR 406

Mouse Diazepam Binding Inhibitor AssayLite Antibody (FITC Conjugate)

33372-05141 AssayPro 150 ug
EUR 428

Mouse Diazepam Binding Inhibitor AssayLite Antibody (RPE Conjugate)

33372-05151 AssayPro 150 ug
EUR 428

Mouse Diazepam Binding Inhibitor AssayLite Antibody (APC Conjugate)

33372-05161 AssayPro 150 ug
EUR 428

Mouse Diazepam Binding Inhibitor AssayLite Antibody (PerCP Conjugate)

33372-05171 AssayPro 150 ug
EUR 471

Dbi/ Rat Dbi ELISA Kit

ELI-49488r Lifescience Market 96 Tests
EUR 886

Diazepam ELISA Kit

DEIA053 Creative Diagnostics 96T
EUR 1032
Description: The Diazepam ELISA Test Kit is a competitive enzyme immunoassay for the quantitative analysis of Diazepam in tissue, feed and urine.

Human Diazepam Binding Inhibitor AssayLite Multi-Color Conjugated Antibodies Flow Cytometry Kit

FACS32991M AssayPro Kit
EUR 693

Human Acyl-CoA-binding protein(DBI) ELISA kit

E01A1824-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyl-CoA-binding protein(DBI) ELISA kit

E01A1824-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyl-CoA-binding protein(DBI) ELISA kit

E01A1824-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyl- CoA- binding protein, DBI ELISA KIT

ELI-49886h Lifescience Market 96 Tests
EUR 824

DBI ELISA kit

55R-1872 Fitzgerald 1 kit
EUR 743
Description: ELISA kit for the detection of DBI in the research laboratory

Diazepam (DZP) ELISA Kit

abx364897-96tests Abbexa 96 tests
EUR 637
  • Shipped within 5-12 working days.

Goat Acyl-CoA-binding protein(DBI) ELISA kit

E06A1824-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acyl-CoA-binding protein(DBI) ELISA kit

E06A1824-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acyl-CoA-binding protein(DBI) ELISA kit

E06A1824-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acyl-CoA-binding protein(DBI) ELISA kit

E03A1824-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acyl-CoA-binding protein(DBI) ELISA kit

E03A1824-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acyl-CoA-binding protein(DBI) ELISA kit

E03A1824-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acyl-CoA-binding protein(DBI) ELISA kit

E04A1824-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acyl-CoA-binding protein(DBI) ELISA kit

E04A1824-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acyl-CoA-binding protein(DBI) ELISA kit

E04A1824-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acyl-CoA-binding protein(DBI) ELISA kit

E02A1824-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acyl-CoA-binding protein(DBI) ELISA kit

E02A1824-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acyl-CoA-binding protein(DBI) ELISA kit

E02A1824-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acyl-CoA-binding protein(DBI) ELISA kit

E07A1824-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acyl-CoA-binding protein(DBI) ELISA kit

E07A1824-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acyl-CoA-binding protein(DBI) ELISA kit

E07A1824-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acyl-CoA-binding protein(DBI) ELISA kit

E09A1824-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acyl-CoA-binding protein(DBI) ELISA kit

E09A1824-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acyl-CoA-binding protein(DBI) ELISA kit

E09A1824-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acyl-CoA-binding protein(DBI) ELISA kit

E08A1824-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acyl-CoA-binding protein(DBI) ELISA kit

E08A1824-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acyl-CoA-binding protein(DBI) ELISA kit

E08A1824-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acyl- CoA- binding protein, DBI ELISA KIT

ELI-11875Ra Lifescience Market 96 Tests
EUR 928

Chicken Acyl- CoA- binding protein, DBI ELISA KIT

ELI-12062c Lifescience Market 96 Tests
EUR 928

Bovine Acyl- CoA- binding protein, DBI ELISA KIT

ELI-35085b Lifescience Market 96 Tests
EUR 928

Mouse Acyl- CoA- binding protein, Dbi ELISA KIT

ELI-35108m Lifescience Market 96 Tests
EUR 865

Porcine Acyl- CoA- binding protein, DBI ELISA KIT

ELI-49887p Lifescience Market 96 Tests
EUR 928

Rat Acyl-CoA-Binding Protein (DBI) ELISA Kit

abx391221-96tests Abbexa 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Acyl-CoA-binding protein (DBI)

1-CSB-EP006519HU Cusabio
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 15.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Acyl-CoA-binding protein(DBI) expressed in E.coli

Human DBI (ACBP) ELISA kit

LF-EK0116 Abfrontier 1×96T
EUR 603

DBI ELISA Kit (Human) (OKCD00917)

OKCD00917 Aviva Systems Biology 96 Wells
EUR 831
Description: Description of target: Binds medium- and long-chain acyl-CoA esters with very high affinity and may function as an intracellular carrier of acyl-CoA esters. It is also able to displace diazepam from the benzodiazepine (BZD) recognition site located on the GABA type A receptor. It is therefore possible that this protein also acts as a neuropeptide to modulate the action of the GABA receptor. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.127 ng/mL

DBI ELISA Kit (Human) (OKAN06390)

OKAN06390 Aviva Systems Biology 96 Wells
EUR 792
Description: Description of target: This gene encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.127 ng/mL

Diazepam

AG109 Unibiotest 1 mg
EUR 523

Diazepam

AT109 Unibiotest 1mg
EUR 1368

Dbi ELISA Kit| Rat Acyl-CoA-binding protein ELISA Kit

EF018575 Lifescience Market 96 Tests
EUR 689

Dbi ELISA Kit| Mouse Acyl-CoA-binding protein ELISA Kit

EF014687 Lifescience Market 96 Tests
EUR 689

DBI ELISA Kit| chicken Acyl-CoA-binding protein ELISA Kit

EF012281 Lifescience Market 96 Tests
EUR 689

DBI ELISA Kit| Bovine Acyl-CoA-binding protein ELISA Kit

EF011315 Lifescience Market 96 Tests
EUR 689

Canine DBI ELISA KIT

ELI-49447d Lifescience Market 96 Tests
EUR 928

Guinea pig Acyl-CoA-binding protein(DBI) ELISA kit

E05A1824-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Acyl-CoA-binding protein(DBI) ELISA kit

E05A1824-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Acyl-CoA-binding protein(DBI) ELISA kit

E05A1824-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Acyl-CoA-binding protein(DBI) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Inhibitor k Binding ELISA kit

E01I0025-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Inhibitor k Binding ELISA kit

E01I0025-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Inhibitor k Binding ELISA kit

E01I0025-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DBI (ACBP) ELISA kit (4X96T)

LF-EK0117 Abfrontier 4×96T
EUR 2045

Human DBI (ACBP) ELISA kit (10X96T)

LF-EK0118 Abfrontier 10×96T
EUR 4484

Mouse Acyl-CoA-binding protein (Dbi)

1-CSB-EP006519MO Cusabio
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 16.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Acyl-CoA-binding protein(Dbi) expressed in E.coli

Rat Acyl-CoA-binding protein (Dbi)

1-CSB-EP006519RA Cusabio
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 16.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Acyl-CoA-binding protein(Dbi) expressed in E.coli

Diazepam antibody

20-1238 Fitzgerald 100 ul
EUR 657
Description: Sheep polyclonal Diazepam antibody

Diazepam [HRP]

DAGA-081H Creative Diagnostics 1mg
EUR 1170

Diazepam [BSA]

DAGA-093B Creative Diagnostics 1mg
EUR 780

Diazepam [KLH]

DAGA-099K Creative Diagnostics 1mg
EUR 1040

DBI ELISA Kit (Mouse) (OKCD00402)

OKCD00402 Aviva Systems Biology 96 Wells
EUR 857
Description: Description of target: Binds medium- and long-chain acyl-CoA esters with very high affinity and may function as an intracellular carrier of acyl-CoA esters. It is also able to displace diazepam from the benzodiazepine (BZD) recognition site located on the GABA type A receptor. It is therefore possible that this protein also acts as a neuropeptide to modulate the action of the GABA receptor. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 2.67 ng/mL

DBI ELISA Kit (Mouse) (OKAN06448)

OKAN06448 Aviva Systems Biology 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.065 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 Alpha Diagnostics 1
EUR 202

Goat Inhibitor k Binding ELISA kit

E06I0025-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Inhibitor k Binding ELISA kit

E06I0025-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Inhibitor k Binding ELISA kit

E06I0025-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Inhibitor k Binding ELISA kit

E02I0025-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Inhibitor k Binding ELISA kit

E02I0025-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Inhibitor k Binding ELISA kit

E02I0025-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Inhibitor k Binding ELISA kit

E03I0025-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Inhibitor k Binding ELISA kit

E03I0025-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Inhibitor k Binding ELISA kit

E03I0025-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Inhibitor k Binding ELISA kit

E04I0025-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Inhibitor k Binding ELISA kit

E04I0025-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Inhibitor k Binding ELISA kit

E04I0025-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Inhibitor k Binding ELISA kit

E08I0025-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Inhibitor k Binding ELISA kit

E08I0025-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Inhibitor k Binding ELISA kit

E08I0025-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Inhibitor k Binding ELISA kit

E07I0025-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Inhibitor k Binding ELISA kit

E07I0025-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Inhibitor k Binding ELISA kit

E07I0025-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Inhibitor k Binding ELISA kit

E09I0025-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Inhibitor k Binding ELISA kit

E09I0025-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Inhibitor k Binding ELISA kit

E09I0025-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

DBI siRNA

20-abx901415 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DBI siRNA

20-abx913599 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DBI siRNA

20-abx913600 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DBI antibody

70R-2557 Fitzgerald 50 ug
EUR 467
Description: Rabbit polyclonal DBI antibody

DBI Antibody

ABD7307 Lifescience Market 100 ug
EUR 438

DBI antibody

10R-7489 Fitzgerald 100 ul
EUR 393
Description: Mouse monoclonal DBI antibody

DBI antibody

10R-7490 Fitzgerald 100 ul
EUR 393
Description: Mouse monoclonal DBI antibody

DBI Antibody

32810-100ul SAB 100ul
EUR 252

DBI antibody

70R-16747 Fitzgerald 50 ul
EUR 435
Description: Rabbit polyclonal DBI antibody

DBI Antibody

DF7307 Affbiotech 200ul
EUR 304
Description: DBI Antibody detects endogenous levels of total DBI.

DBI Antibody

1-CSB-PA000798 Cusabio
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DBI. Recognizes DBI from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

DBI Antibody

1-CSB-PA005119 Cusabio
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DBI. Recognizes DBI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

DBI Antibody

1-CSB-PA006519GA01HU Cusabio
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DBI. Recognizes DBI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DBI Antibody

1-CSB-PA006519HA01HU Cusabio
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DBI. Recognizes DBI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Guinea pig Inhibitor k Binding ELISA kit

E05I0025-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Inhibitor k Binding ELISA kit

E05I0025-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Inhibitor k Binding ELISA kit

E05I0025-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Inhibitor k Binding in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DBI shRNA Plasmid

20-abx951143 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DBI Recombinant Protein (Human)

RP008779 ABM 100 ug Ask for price

Frit Kit

FRIT-KIT Next Advance 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

DBI Conjugated Antibody

C32810 SAB 100ul
EUR 397

DBI cloning plasmid

CSB-CL006519HU-10ug Cusabio 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 315
  • Sequence: atgtggggcgacctctggctcctcccgcctgcctctgccaatccgggcactgggacagaggctgagtttgagaaagctgcagaggaggttaggcaccttaagaccaagccatcggatgaggagatgctgttcatctatggccactacaaacaagcaactgtgggcgacataaatac
  • Show more
Description: A cloning plasmid for the DBI gene.

anti- DBI antibody

FNab02256 FN Test 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein)
  • Uniprot ID: P07108
  • Gene ID: 1622
  • Research Area: Metabolism
Description: Antibody raised against DBI

DBI Blocking Peptide

20-abx162385 Abbexa
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human DBI(Diazepam Binding Inhibitor) ELISA Kit

Recent Posts
  • ANTIBODY FINDER, PROTEINS AND ELISA KITS
  • QPCR Troubleshooting Guide
  • An up-to-date review on bio-resource therapeutics effective against bacterial species frequently associated with chronic sinusitis and tonsillitis
  • Bio-Fabrication: Convergence of 3D Bioprinting and Nano-Biomaterials in Tissue Engineering and Regenerative Medicine
  • Recognition of Patient Groups with Sleep Related Disorders using Bio-signal Processing and Deep Learning
Categories
  • An up-to-date review on bio-resource therapeutics effective against bacterial species frequently associated with chronic sinusitis and tonsillitis.
  • Bio-chemo-electro-mechanical modelling of the rapid movement of Mimosa pudica
  • Bio-Fabrication: Convergence of 3D Bioprinting and Nano-Biomaterials in Tissue Engineering and Regenerative Medicine
  • Exploring the additive bio-agent impacts upon ectoine production by Halomonas salina DSM5928T using corn steep liquor and soybean hydrolysate as nutrient supplement
  • Recognition of Patient Groups with Sleep Related Disorders using Bio-signal Processing and Deep Learning
  • Uncategorized

© 2019 All Right Reserved | Arowana WordPress Theme