Skip to content
Theragen Bio

Research Data

  • Home
  • Western Blot Reagents
  • Body’s bugs to be sequenced
  • Our products
  • Home
  • Western Blot Reagents
  • Body’s bugs to be sequenced
  • Our products

Human THBS3(Thrombospondin 3) ELISA Kit

  • Home
  • Human THBS3(Thrombospondin 3) ELISA Kit

Human THBS3(Thrombospondin 3) ELISA Kit

Human Thrombospondin 3 (THBS3) ELISA Kit

RDR-THBS3-Hu-48Tests Reddot Biotech 48 Tests
EUR 544

Human Thrombospondin 3 (THBS3) ELISA Kit

RDR-THBS3-Hu-96Tests Reddot Biotech 96 Tests
EUR 756

Human Thrombospondin 3 (THBS3) ELISA Kit

RD-THBS3-Hu-48Tests Reddot Biotech 48 Tests
EUR 521

Human Thrombospondin 3 (THBS3) ELISA Kit

RD-THBS3-Hu-96Tests Reddot Biotech 96 Tests
EUR 723

Mouse Thrombospondin 3 (THBS3) ELISA Kit

DLR-THBS3-Mu-48T DL Develop 48T
EUR 527
  • Should the Mouse Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 3 (THBS3) in samples from plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit

DLR-THBS3-Mu-96T DL Develop 96T
EUR 688
  • Should the Mouse Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 3 (THBS3) in samples from plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit

RDR-THBS3-Mu-48Tests Reddot Biotech 48 Tests
EUR 557

Mouse Thrombospondin 3 (THBS3) ELISA Kit

RDR-THBS3-Mu-96Tests Reddot Biotech 96 Tests
EUR 774

Mouse Thrombospondin 3 (THBS3) ELISA Kit

RD-THBS3-Mu-48Tests Reddot Biotech 48 Tests
EUR 533

Mouse Thrombospondin 3 (THBS3) ELISA Kit

RD-THBS3-Mu-96Tests Reddot Biotech 96 Tests
EUR 740

Human Thrombospondin- 3, THBS3 ELISA KIT

ELI-36583h Lifescience Market 96 Tests
EUR 824

Human Thrombospondin 3 (THBS3) ELISA Kit

20-abx156876 Abbexa
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Thrombospondin 3 (THBS3) ELISA Kit

abx259888-96tests Abbexa 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Thrombospondin 3 (THBS3) ELISA Kit

SED823Hu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit

SED823Hu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit

SED823Hu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit

SED823Hu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.

Human Thrombospondin 3 (THBS3) ELISA Kit

4-SED823Hu Cloud-Clone
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species.

Mouse Thrombospondin- 3, Thbs3 ELISA KIT

ELI-17025m Lifescience Market 96 Tests
EUR 865

Mouse Thrombospondin 3 (THBS3) ELISA Kit

20-abx154756 Abbexa
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Thrombospondin 3 (THBS3) ELISA Kit

SED823Mu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit

SED823Mu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit

SED823Mu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit

SED823Mu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.

Mouse Thrombospondin 3 (THBS3) ELISA Kit

4-SED823Mu Cloud-Clone
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human THBS3 (Thrombospondin 3)

ELK5166 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
  • Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Thrombospondin 3 (THBS3) CLIA Kit

20-abx494398 Abbexa
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Thrombospondin 3 (THBS3) Antibody

20-abx123257 Abbexa
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody

20-abx116967 Abbexa
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody

20-abx128997 Abbexa
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thrombospondin 3 (THBS3) Antibody

20-abx110655 Abbexa
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody

20-abx110656 Abbexa
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody

abx030681-400ul Abbexa 400 ul
EUR 523
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody

abx030681-80l Abbexa 80 µl
EUR 286
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody

20-abx320416 Abbexa
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody

abx431668-200ul Abbexa 200 ul
EUR 384
  • Shipped within 1-3 working days.

Thrombospondin 3 (THBS3) Antibody

abx238675-100ug Abbexa 100 ug
EUR 509
  • Shipped within 5-12 working days.

Thrombospondin 3 (THBS3) Antibody

20-abx178573 Abbexa
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Thrombospondin 3 (THBS3) Antibody

20-abx178574 Abbexa
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Thrombospondin-3 (Thbs3)

1-CSB-YP023489MO Cusabio
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 37.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in Yeast

Mouse Thrombospondin-3 (Thbs3)

1-CSB-EP023489MO Cusabio
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 62.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in E.coli

Recombinant Thrombospondin 3 (THBS3)

4-RPD823Hu01 Cloud-Clone
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P49746
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Thrombospondin 3 expressed in: E.coli

Human Thrombospondin 3 (THBS3) Protein

20-abx166577 Abbexa
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Mouse THBS3 (Thrombospondin 3)

ELK6457 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
  • Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Thrombospondin 3 (THBS3) CLIA Kit

20-abx494399 Abbexa
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Thrombospondin 3 (THBS3) Protein

20-abx655225 Abbexa
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Thrombospondin 3 (THBS3) Protein

20-abx655226 Abbexa
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Thrombospondin 3 (THBS3) Antibody (HRP)

20-abx109221 Abbexa
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (HRP)

20-abx109222 Abbexa
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (Biotin)

20-abx106391 Abbexa
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (Biotin)

20-abx106392 Abbexa
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (FITC)

20-abx107803 Abbexa
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Antibody (FITC)

20-abx107804 Abbexa
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human)

4-PAD823Hu01 Cloud-Clone
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3)

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC

4-PAD823Hu01-APC Cloud-Clone
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Biotinylated

4-PAD823Hu01-Biotin Cloud-Clone
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Biotin.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Cy3

4-PAD823Hu01-Cy3 Cloud-Clone
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Cy3.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), FITC

4-PAD823Hu01-FITC Cloud-Clone
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with FITC.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), HRP

4-PAD823Hu01-HRP Cloud-Clone
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with HRP.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), PE

4-PAD823Hu01-PE Cloud-Clone
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with PE.

Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC-Cy7

4-PAD823Hu01-APC-Cy7 Cloud-Clone
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC-Cy7.

Polyclonal THBS3 / Thrombospondin 3 Antibody (C-Terminus)

AMM08184G Leading Biology 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human THBS3 / Thrombospondin 3 (C-Terminus). This antibody is tested and proven to work in the following applications:

THBS3 ELISA Kit (Human) (OKCD00691)

OKCD00691 Aviva Systems Biology 96 Wells
EUR 831
Description: Description of target: Adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. Can bind to fibrinogen, fibronectin, laminin and type V collagen. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.61 ng/mL

Thrombospondin 3 ELISA KIT|Human

EF003592 Lifescience Market 96 Tests
EUR 689

Thbs3 ELISA Kit (Mouse) (OKCD01781)

OKCD01781 Aviva Systems Biology 96 Wells
EUR 857
Description: Description of target: Adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. Can bind to fibrinogen, fibronectin, laminin and type V collagen. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 25.3 pg/mL

Human Thrombospondin 3 (TSP-3)ELISA Kit

201-12-2387 SunredBio 96 tests
EUR 440
  • This Thrombospondin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Thrombospondin 3(TSP-3)ELISA Kit

QY-E00634 Qayee Biotechnology 96T
EUR 361

THBS3 siRNA

20-abx936680 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

THBS3 siRNA

20-abx936681 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

THBS3 antibody

70R-21720 Fitzgerald 50 ul
EUR 435
Description: Rabbit polyclonal THBS3 antibody

Thbs3 Antibody

1-CSB-PA023489DA01MO Cusabio
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

Thbs3 Antibody

1-CSB-PA023489EA01MO Cusabio
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

THBS3 Antibody

1-CSB-PA023489ESR2HU Cusabio
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

THBS3 Antibody

1-CSB-PA023489GA01HU Cusabio
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 Alpha Diagnostics 1
EUR 202

Human THBS3 shRNA Plasmid

20-abx954831 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

THBS3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2368904 ABM 1.0 ug DNA
EUR 154

Human Thrombospondin 1 ELISA kit

E01T0763-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 1 ELISA kit

E01T0763-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 1 ELISA kit

E01T0763-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin-2 ELISA kit

LF-EK50605 Abfrontier 1×96T
EUR 648

THBS3 cloning plasmid

CSB-CL023489HU-10ug Cusabio 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1458
  • Sequence: ATGGACAACAACAAACACTGCAAACAGGACAACTGCCTTTTGACACCCAACTCTGGGCAGGAAGATGCTGATAATGATGGTGTGGGGGACCAGTGTGATGATGATGCTGATGGGGATGGGATCAAGAATGTTGAGGACAACTGCCGGCTGTTCCCCAACAAAGACCAGCAGAACT
  • Show more
Description: A cloning plasmid for the THBS3 gene.

THBS3 Rabbit pAb

A3641-100ul Abclonal 100 ul
EUR 308

THBS3 Rabbit pAb

A3641-200ul Abclonal 200 ul
EUR 459

THBS3 Rabbit pAb

A3641-20ul Abclonal 20 ul
EUR 183

THBS3 Rabbit pAb

A3641-50ul Abclonal 50 ul
EUR 223

Thbs3 Polyclonal Antibody

A57726 EpiGentek 100 µg
EUR 570.55
Description: fast delivery possible

Thbs3 Polyclonal Antibody

A57777 EpiGentek 100 µg
EUR 570.55
Description: Ask the seller for details

Anti-THBS3 antibody

STJ71847 St John's Laboratory 100 µg
EUR 359

Anti-THBS3 antibody

STJ25845 St John's Laboratory 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants.

FSH (Human Follicle-stimulating hormone) ELISA test

3 Biobase 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)

THBS3 ORF Vector (Human) (pORF)

ORF014707 ABM 1.0 ug DNA
EUR 354

Human Thrombospondin 4 (THBS4) ELISA Kit

abx571192-96tests Abbexa 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Thrombospondin 1 (THBS1) ELISA Kit

abx571959-96tests Abbexa 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Thrombospondin 2 (THBS2) ELISA Kit

abx576059-96tests Abbexa 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Thrombospondin 1(THBS1) ELISA kit

E01T0686-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 1(THBS1) ELISA kit

E01T0686-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 1(THBS1) ELISA kit

E01T0686-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 2(THBS2) ELISA kit

E01T0687-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 2(THBS2) ELISA kit

E01T0687-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thrombospondin 2(THBS2) ELISA kit

E01T0687-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human THBS1/ Thrombospondin-1 ELISA Kit

E2490Hu Sunlong 1 Kit
EUR 537

Human THBS2/ Thrombospondin-2 ELISA Kit

E2491Hu Sunlong 1 Kit
EUR 537

Human THBS4/ Thrombospondin-4 ELISA Kit

E2492Hu Sunlong 1 Kit
EUR 571

Human THBS4(Thrombospondin-4) ELISA Kit

EH0795 FN Test 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P35443
  • Alias: TSP-4(Thrombospondin-4)/THBS4
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Thrombospondin- 1, THBS1 ELISA KIT

ELI-02195h Lifescience Market 96 Tests
EUR 824

Human Thrombospondin- 2, THBS2 ELISA KIT

ELI-06100h Lifescience Market 96 Tests
EUR 824

Human Thrombospondin 1 (THBS1) ELISA Kit

20-abx153283 Abbexa
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Thrombospondin 2 (THBS2) ELISA Kit

20-abx153284 Abbexa
  • EUR 5311.00
  • EUR 2837.00
  • EUR 668.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Thrombospondin 4 (THBS4) ELISA Kit

20-abx153285 Abbexa
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Thrombospondin 1 (THBS1) ELISA Kit

abx052577-96tests Abbexa 96 tests
EUR 786
  • Shipped within 5-10 working days.

Human Thrombospondin-2 (JAK2) ELISA Kit

abx050226-96tests Abbexa 96 tests
EUR 668
  • Shipped within 5-10 working days.

Human Thrombospondin 1 (THBS1) ELISA Kit

abx253325-96tests Abbexa 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Thrombospondin 4 (THBS4) ELISA Kit

abx253326-96tests Abbexa 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Thrombospondin 4 (THBS4) ELISA Kit

abx253753-96tests Abbexa 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Thrombospondin 2 (THBS2) ELISA Kit

abx250162-96tests Abbexa 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Thrombospondin 1 (THBS1) ELISA Kit

DLR-THBS1-Hu-48T DL Develop 48T
EUR 479
  • Should the Human Thrombospondin 1 (THBS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 1 (THBS1) in samples from plasma.

Human Thrombospondin 1 (THBS1) ELISA Kit

DLR-THBS1-Hu-96T DL Develop 96T
EUR 621
  • Should the Human Thrombospondin 1 (THBS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 1 (THBS1) in samples from plasma.

Human Thrombospondin 2 (THBS2) ELISA Kit

DLR-THBS2-Hu-48T DL Develop 48T
EUR 387
  • Should the Human Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.

Human Thrombospondin 2 (THBS2) ELISA Kit

DLR-THBS2-Hu-96T DL Develop 96T
EUR 494
  • Should the Human Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.

Human Thrombospondin 4 (THBS4) ELISA Kit

DLR-THBS4-Hu-48T DL Develop 48T
EUR 517
  • Should the Human Thrombospondin 4 (THBS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 4 (THBS4) in samples from serum, plasma or other biological fluids.

Human Thrombospondin 4 (THBS4) ELISA Kit

DLR-THBS4-Hu-96T DL Develop 96T
EUR 673
  • Should the Human Thrombospondin 4 (THBS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 4 (THBS4) in samples from serum, plasma or other biological fluids.

Human Thrombospondin-2(THBS2) ELISA kit

CSB-EL023488HU-24T Cusabio 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Thrombospondin-2 (THBS2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Thrombospondin-2(THBS2) ELISA kit

1-CSB-EL023488HU Cusabio
  • EUR 602.00
  • EUR 4238.00
  • EUR 2256.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Thrombospondin-2(THBS2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Thrombospondin-4(THBS4) ELISA kit

CSB-EL023490HU-24T Cusabio 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Thrombospondin-4 (THBS4) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Thrombospondin-4(THBS4) ELISA kit

1-CSB-EL023490HU Cusabio
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Thrombospondin-4(THBS4) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Thrombospondin-2 ELISA kit (4X96T)

LF-EK50606 Abfrontier 4×96T
EUR 2201

Human Thrombospondin 1 (THBS1) ELISA Kit

SEA611Hu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma.

Human Thrombospondin 1 (THBS1) ELISA Kit

SEA611Hu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma.

Human Thrombospondin 1 (THBS1) ELISA Kit

SEA611Hu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma.

Human Thrombospondin 1 (THBS1) ELISA Kit

SEA611Hu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma.

Human Thrombospondin 1 (THBS1) ELISA Kit

4-SEA611Hu Cloud-Clone
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 1 elisa. Alternative names of the recognized antigen: TSP1
  • Thrombospondin-1p180
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 1 (THBS1) in samples from plasma with no significant corss-reactivity with analogues from other species.

Human Thrombospondin 1 (THBS1) ELISA Kit

RDR-THBS1-Hu-48Tests Reddot Biotech 48 Tests
EUR 500

Human Thrombospondin 1 (THBS1) ELISA Kit

RDR-THBS1-Hu-96Tests Reddot Biotech 96 Tests
EUR 692

Human Thrombospondin 2 (THBS2) ELISA Kit

RDR-THBS2-Hu-48Tests Reddot Biotech 48 Tests
EUR 390

Human Thrombospondin 2 (THBS2) ELISA Kit

RDR-THBS2-Hu-96Tests Reddot Biotech 96 Tests
EUR 536

Human Thrombospondin 4 (THBS4) ELISA Kit

RDR-THBS4-Hu-48Tests Reddot Biotech 48 Tests
EUR 544

Human Thrombospondin 4 (THBS4) ELISA Kit

RDR-THBS4-Hu-96Tests Reddot Biotech 96 Tests
EUR 756

Human Thrombospondin 1 ELISA Kit (THBS1)

RK02384 Abclonal 96 Tests
EUR 521

Human Thrombospondin 1 (THBS1) ELISA Kit

RD-THBS1-Hu-48Tests Reddot Biotech 48 Tests
EUR 478

Human Thrombospondin 1 (THBS1) ELISA Kit

RD-THBS1-Hu-96Tests Reddot Biotech 96 Tests
EUR 662

Human Thrombospondin 2 (THBS2) ELISA Kit

RD-THBS2-Hu-48Tests Reddot Biotech 48 Tests
EUR 374

Human Thrombospondin 2 (THBS2) ELISA Kit

RD-THBS2-Hu-96Tests Reddot Biotech 96 Tests
EUR 513

Human Thrombospondin 4 (THBS4) ELISA Kit

RD-THBS4-Hu-48Tests Reddot Biotech 48 Tests
EUR 521

Human Thrombospondin 4 (THBS4) ELISA Kit

RD-THBS4-Hu-96Tests Reddot Biotech 96 Tests
EUR 723

Human Thrombospondin 2 (THBS2) ELISA Kit

SED822Hu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 3147.61
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.

Human Thrombospondin 2 (THBS2) ELISA Kit

SED822Hu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 346.86
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.

Human Thrombospondin 2 (THBS2) ELISA Kit

SED822Hu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 452.66
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.

Human Thrombospondin 2 (THBS2) ELISA Kit

SED822Hu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 1736.97
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.

Human Thrombospondin 2 (THBS2) ELISA Kit

4-SED822Hu Cloud-Clone
  • EUR 3198.00
  • EUR 1687.00
  • EUR 453.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 2 elisa. Alternative names of the recognized antigen: TSP2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 2 (THBS2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Thrombospondin 4 (THBS4) ELISA Kit

SED824Hu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma.

Human Thrombospondin 4 (THBS4) ELISA Kit

SED824Hu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma.

Human Thrombospondin 4 (THBS4) ELISA Kit

SED824Hu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma.

Human Thrombospondin 4 (THBS4) ELISA Kit

SED824Hu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma.

Human Thrombospondin 4 (THBS4) ELISA Kit

4-SED824Hu Cloud-Clone
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 4 elisa. Alternative names of the recognized antigen: TSP4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 4 (THBS4) in samples from Plasma with no significant corss-reactivity with analogues from other species.

Frit Kit

FRIT-KIT Next Advance 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Thbs3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4897004 ABM 1.0 ug DNA
EUR 154

Thbs3 3'UTR GFP Stable Cell Line

TU170448 ABM 1.0 ml Ask for price

THBS3 3'UTR GFP Stable Cell Line

TU075528 ABM 1.0 ml
EUR 1521

Thbs3 3'UTR Luciferase Stable Cell Line

TU120448 ABM 1.0 ml Ask for price

THBS3 3'UTR Luciferase Stable Cell Line

TU025528 ABM 1.0 ml
EUR 1521

Mouse THBS3 shRNA Plasmid

20-abx973102 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Thbs3 Antibody, HRP conjugated

1-CSB-PA023489DB01MO Cusabio
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Thbs3 Antibody, FITC conjugated

1-CSB-PA023489DC01MO Cusabio
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Thbs3 Antibody, Biotin conjugated

1-CSB-PA023489DD01MO Cusabio
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Thbs3 Antibody, HRP conjugated

1-CSB-PA023489EB01MO Cusabio
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Thbs3 Antibody, FITC conjugated

1-CSB-PA023489EC01MO Cusabio
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Thbs3 Antibody, Biotin conjugated

1-CSB-PA023489ED01MO Cusabio
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Column Packing Kit

PACK-KIT Next Advance 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Dr. P Kit-Solution 3

K2021010-3 Biochain 50 ml
EUR 133
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

THBS3 sgRNA CRISPR Lentivector set (Human)

K2368901 ABM 3 x 1.0 ug
EUR 339

PCR Mycoplasma Detection Kit

M034-Kit TOKU-E Kit
EUR 266

Mouse Thrombospondin 1 ELISA kit

E03T0763-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Thrombospondin 1 ELISA kit

E03T0763-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Thrombospondin 1 ELISA kit

E03T0763-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Thrombospondin 1 ELISA kit

E02T0763-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Thrombospondin 1 ELISA kit

E02T0763-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Thrombospondin 1 ELISA kit

E02T0763-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thrombospondin 1 ELISA kit

E04T0763-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thrombospondin 1 ELISA kit

E04T0763-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thrombospondin 1 ELISA kit

E04T0763-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Thrombospondin 1 ELISA kit

E08T0763-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Thrombospondin 1 ELISA kit

E08T0763-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Thrombospondin 1 ELISA kit

E08T0763-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Thrombospondin 1 ELISA kit

E07T0763-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Thrombospondin 1 ELISA kit

E07T0763-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Thrombospondin 1 ELISA kit

E07T0763-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Thrombospondin 1 ELISA kit

E06T0763-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Thrombospondin 1 ELISA kit

E06T0763-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Thrombospondin 1 ELISA kit

E06T0763-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Thrombospondin 1 ELISA kit

E09T0763-192T B-Gene 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Thrombospondin 1 ELISA kit

E09T0763-48 B-Gene 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Thrombospondin 1 ELISA kit

E09T0763-96 B-Gene 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Thrombospondin-2 (THBS2)

EK0285 SAB 96 tests
EUR 712
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Thrombospondin-2 (THBS2) in samples from serum, plasma, tissue homogenates and other biological fluids.

Human TSP-1(Thrombospondin-1) ELISA Kit

EH3924 FN Test 96T
EUR 524.1
  • Detection range: 3.125-200 ng/ml
  • Alias: TSP-1/THBS1/TSP-1/THBS/THBS-1/thrombospondin 1/thrombospondin-1p180/TSP1thrombospondin-1/TSPTSP-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Human TSP-2(Thrombospondin-2) ELISA Kit

EH0023 FN Test 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P35442
  • Alias: TSP-2(Thrombospondin-2)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

ELISA kit for Human THBS4 (Thrombospondin 4)

ELK3767 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 4 (THBS4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
  • Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human THBS2 (Thrombospondin 2)

ELK1335 ELK Biotech 1 plate of 96 wells
EUR 372
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 2 (THBS2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
  • Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human THBS1 (Thrombospondin 1)

ELK1685 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 1 (THBS1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
  • Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human thrombospondin 1(TSP-1)ELISA Kit

GA-E1127HM-48T GenAsia Biotech 48T
EUR 289

Human thrombospondin 1(TSP-1)ELISA Kit

GA-E1127HM-96T GenAsia Biotech 96T
EUR 466

Human THBS3(Thrombospondin 3) ELISA Kit

Recent Posts
  • ANTIBODY FINDER, PROTEINS AND ELISA KITS
  • QPCR Troubleshooting Guide
  • An up-to-date review on bio-resource therapeutics effective against bacterial species frequently associated with chronic sinusitis and tonsillitis
  • Bio-Fabrication: Convergence of 3D Bioprinting and Nano-Biomaterials in Tissue Engineering and Regenerative Medicine
  • Recognition of Patient Groups with Sleep Related Disorders using Bio-signal Processing and Deep Learning
Categories
  • An up-to-date review on bio-resource therapeutics effective against bacterial species frequently associated with chronic sinusitis and tonsillitis.
  • Bio-chemo-electro-mechanical modelling of the rapid movement of Mimosa pudica
  • Bio-Fabrication: Convergence of 3D Bioprinting and Nano-Biomaterials in Tissue Engineering and Regenerative Medicine
  • Exploring the additive bio-agent impacts upon ectoine production by Halomonas salina DSM5928T using corn steep liquor and soybean hydrolysate as nutrient supplement
  • Recognition of Patient Groups with Sleep Related Disorders using Bio-signal Processing and Deep Learning
  • Uncategorized

© 2019 All Right Reserved | Arowana WordPress Theme