Human KTN1(Kinectin 1) ELISA Kit

Human KTN1(Kinectin 1) ELISA Kit

Human Kinectin 1 (KTN1) ELISA Kit

SEC558Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kinectin 1 (KTN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kinectin 1 (KTN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Kinectin 1 (KTN1) ELISA Kit

SEC558Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kinectin 1 (KTN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kinectin 1 (KTN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Kinectin 1 (KTN1) ELISA Kit

SEC558Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kinectin 1 (KTN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kinectin 1 (KTN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Kinectin 1 (KTN1) ELISA Kit

SEC558Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kinectin 1 (KTN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kinectin 1 (KTN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Kinectin 1 (KTN1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kinectin 1 elisa. Alternative names of the recognized antigen: CG1
  • KNT
  • Kinesin Receptor
  • CG-1 antigen
  • Kinesin receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kinectin 1 (KTN1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Kinectin, KTN1 ELISA KIT

ELI-43334h 96 Tests
EUR 824

Kinectin 1 (KTN1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kinectin 1 (KTN1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kinectin 1 (KTN1) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kinectin 1 (KTN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kinectin 1 (KTN1) Antibody

abx146420-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Kinectin 1 (KTN1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kinectin 1 (KTN1) Antibody

abx234660-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Kinectin 1 (KTN1)

  • EUR 444.06
  • EUR 222.00
  • EUR 1390.24
  • EUR 530.08
  • EUR 960.16
  • EUR 360.00
  • EUR 3325.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q86UP2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Kinectin 1 expressed in: E.coli

Recombinant Kinectin 1 (KTN1)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D4A4Z9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Kinectin 1 expressed in: E.coli

Human Kinectin 1 (KTN1) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1873.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Human KTN1 (Kinectin 1)

ELK5160 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kinectin 1 (KTN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kinectin 1 (KTN1
  • Show more
Description: A sandwich ELISA kit for detection of Kinectin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Kinectin 1 (KTN1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Kinectin, Ktn1 ELISA KIT

ELI-08766m 96 Tests
EUR 865

Chicken Kinectin, KTN1 ELISA KIT

ELI-12505c 96 Tests
EUR 928

ELISA kit for Human Kinectin (KTN1)

KTE61871-48T 48T
EUR 332
  • Kinectin is a protein encoded by the KTN1 gene.Various cellular organelles and vesicles are transported along the microtubules in the cytoplasm. Likewise, membrane recycling of the endoplasmic reticulum (ER), Golgi assembly at the microtubule organiz
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kinectin (KTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kinectin (KTN1)

KTE61871-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Kinectin is a protein encoded by the KTN1 gene.Various cellular organelles and vesicles are transported along the microtubules in the cytoplasm. Likewise, membrane recycling of the endoplasmic reticulum (ER), Golgi assembly at the microtubule organiz
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kinectin (KTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kinectin (KTN1)

KTE61871-96T 96T
EUR 539
  • Kinectin is a protein encoded by the KTN1 gene.Various cellular organelles and vesicles are transported along the microtubules in the cytoplasm. Likewise, membrane recycling of the endoplasmic reticulum (ER), Golgi assembly at the microtubule organiz
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kinectin (KTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Kinectin 1 (KTN1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kinectin 1 (KTN1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kinectin 1 (KTN1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat Kinectin 1 (KTN1) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1)

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1)

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with APC.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with Biotin.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with Cy3.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with FITC.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with HRP.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with PE.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with APC.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with Biotin.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with Cy3.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with FITC.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with HRP.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with PE.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with APC-Cy7.

Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202


EF010598 96 Tests
EUR 689

Kinectin 1 antibody

70R-6709 50 ug
EUR 467
Description: Rabbit polyclonal Kinectin 1 antibody

KTN1 ELISA Kit (Human) (OKCD01205)

OKCD01205 96 Wells
EUR 831
Description: Description of target: Receptor for kinesin thus involved in kinesin-driven vesicle motility. Accumulates in integrin-based adhesion complexes (IAC) upon integrin aggregation by fibronectin. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 30 pg/mL

Recombinant human Kinectin

P2662 100ug Ask for price
  • Uniprot ID: Q86UP2
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Kinectin

Kinectin 1 Blocking Peptide

33R-2373 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KTN1 antibody, catalog no. 70R-6709

KTN1 antibody

70R-18197 50 ul
EUR 435
Description: Rabbit polyclonal KTN1 antibody

KTN1 antibody

38704-100ul 100ul
EUR 252

KTN1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IP:1:200-1:2000

KTN1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Human KTN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

KTN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1191202 1.0 ug DNA
EUR 154

KTN1 Rabbit pAb

A14016-100ul 100 ul
EUR 308

KTN1 Rabbit pAb

A14016-200ul 200 ul
EUR 459

KTN1 Rabbit pAb

A14016-20ul 20 ul
EUR 183

KTN1 Rabbit pAb

A14016-50ul 50 ul
EUR 223

KTN1 Rabbit pAb

A12456-100ul 100 ul
EUR 308

KTN1 Rabbit pAb

A12456-200ul 200 ul
EUR 459

KTN1 Rabbit pAb

A12456-20ul 20 ul
EUR 183

KTN1 Rabbit pAb

A12456-50ul 50 ul
EUR 223

KTN1 Conjugated Antibody

C38704 100ul
EUR 397

KTN1 cloning plasmid

CSB-CL773030HU-10ug 10ug
EUR 1377
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3921
  • Sequence: atggagttttatgagtcagcatattttattgttcttattccttcaatagttattacagtaattttcctcttcttctggcttttcatgaaagaaacattatatgatgaagttcttgcaaaacagaaaagagaacaaaagcttattcctaccaaaacagataaaaagaaagcagaaa
  • Show more
Description: A cloning plasmid for the KTN1 gene.

KTN1 Rabbit pAb

A5879-100ul 100 ul
EUR 308

KTN1 Rabbit pAb

A5879-200ul 200 ul
EUR 459

KTN1 Rabbit pAb

A5879-20ul 20 ul
EUR 183

KTN1 Rabbit pAb

A5879-50ul 50 ul
EUR 223

KTN1 Polyclonal Antibody

A69971 100 ?g
EUR 628.55
Description: The best epigenetics products

anti- KTN1 antibody

FNab04660 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: kinectin 1 (kinesin receptor)
  • Uniprot ID: Q86UP2
  • Gene ID: 3895
  • Research Area: Signal Transduction
Description: Antibody raised against KTN1

Anti-KTN1 antibody

PAab04660 100 ug
EUR 386

Anti-KTN1 antibody

STJ28152 100 µl
EUR 277
Description: This gene encodes an integral membrane protein that is a member of the kinectin protein family. The encoded protein is primarily localized to the endoplasmic reticulum membrane. This protein binds kinesin and may be involved in intracellular organelle motility. This protein also binds translation elongation factor-delta and may be involved in the assembly of the elongation factor-1 complex. Alternate splicing results in multiple transcript variants of this gene.

Anti-KTN1 antibody

STJ114330 100 µl
EUR 277
Description: This gene encodes an integral membrane protein that is a member of the kinectin protein family. The encoded protein is primarily localized to the endoplasmic reticulum membrane. This protein binds kinesin and may be involved in intracellular organelle motility. This protein also binds translation elongation factor-delta and may be involved in the assembly of the elongation factor-1 complex. Alternate splicing results in multiple transcript variants of this gene.

Anti-KTN1 antibody

STJ115951 100 µl
EUR 277
Description: This gene encodes an integral membrane protein that is a member of the kinectin protein family. The encoded protein is primarily localized to the endoplasmic reticulum membrane. This protein binds kinesin and may be involved in intracellular organelle motility. This protein also binds translation elongation factor-delta and may be involved in the assembly of the elongation factor-1 complex. Alternate splicing results in multiple transcript variants of this gene.

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

KTN1 ORF Vector (Human) (pORF)

ORF013543 1.0 ug DNA
EUR 354

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

KTN1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KTN1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KTN1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse KTN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

Ktn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4810402 1.0 ug DNA
EUR 154

KTN1 sgRNA CRISPR Lentivector set (Human)

K1191201 3 x 1.0 ug
EUR 339

KTN1-AS1 ORF Vector (Human) (pORF)

ORF022577 1.0 ug DNA Ask for price

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Human Lipocalin-1 (LCN1) AssayMax ELISA Kit

EL3502-1 96 Well Plate
EUR 477

Human TGF-beta-1 AssayMax ELISA Kit

ET3102-1 96 Well Plate
EUR 477

Human PAI-1/tPA AssayMax ELISA Kit

EP1105-1 96 Well Plate
EUR 417

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit

EK2802-1 96 Well Plate
EUR 477

Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit

EI2200-1 96 Well Plate
EUR 477

Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit

EI2301-1 96 Well Plate
EUR 477

Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit

EP1100-1 96 Well Plate
EUR 417

KTN1 Polyclonal Antibody, HRP Conjugated

A69972 100 ?g
EUR 628.55
Description: kits suitable for this type of research

KTN1 Polyclonal Antibody, FITC Conjugated

A69973 100 ?g
EUR 628.55
Description: fast delivery possible

KTN1 Polyclonal Antibody, Biotin Conjugated

A69974 100 ?g
EUR 628.55
Description: reagents widely cited

Ktn1 ORF Vector (Mouse) (pORF)

ORF048908 1.0 ug DNA
EUR 506

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

KTN1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1191203 1.0 ug DNA
EUR 154

KTN1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1191204 1.0 ug DNA
EUR 154

KTN1 Protein Vector (Human) (pPB-C-His)

PV054169 500 ng
EUR 481

KTN1 Protein Vector (Human) (pPB-N-His)

PV054170 500 ng
EUR 481

KTN1 Protein Vector (Human) (pPM-C-HA)

PV054171 500 ng
EUR 481

KTN1 Protein Vector (Human) (pPM-C-His)

PV054172 500 ng
EUR 481

Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit

EC5752-1 96 Well Plate
EUR 477

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit

EA5001-1 96 Well Plate
EUR 417

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit

EA5101-1 96 Well Plate
EUR 417

Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit

EA5501-1 96 Well Plate
EUR 417

Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit

EE2702-1 96 Well Plate
EUR 477

Human Glutathione Transferase zeta 1 AssayMax ELISA Kit

EG2350-1 96 Well Plate
EUR 477

Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit

EG3928-1 96 Well Plate
EUR 477

Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit

EM5110-1 96 Well Plate
EUR 396

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit

EH5215-1 96 Well Plate
EUR 417

Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit

EI1001-1 96 Well Plate
EUR 477

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

KTN1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1191206 1.0 ug DNA
EUR 167

Rat TIMP-1 AssayMax ELISA Kit

ERT2538-1 96 Well Plate
EUR 477

Human Inhibitor of Growth Protein 1 (ING1) AssayMax ELISA Kit

EI1770-1 96 Well Plate
EUR 477

Human Alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit

EG5001-1 96 Well Plate
EUR 396

Human Alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit

EG5101-1 96 Well Plate
EUR 396

Human NEDD4 Family-Interacting Protein 1 (NDFIP1) AssayMax ELISA Kit

EN2550-1 96 Well Plate
EUR 477

Ktn1 sgRNA CRISPR Lentivector set (Mouse)

K4810401 3 x 1.0 ug
EUR 339

Human Alpha-1-Acid Glycoprotein 2 (ORM2, AGP2) AssayMax ELISA Kit

EG2713-1 96 Well Plate
EUR 417

Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit

EMI2200-1 96 Well Plate
EUR 477

Human Lactoferrin AssayMax ELISA Kit

EL1011-1 96 Well Plate
EUR 417

Human Leptin AssayMax ELISA Kit

EL2001-1 96 Well Plate
EUR 417

Human Lactoferrin AssayMax ELISA Kit

EL2011-1 96 Well Plate
EUR 417

Human Lysozyme AssayMax ELISA Kit

EL3010-1 96 Well Plate
EUR 396

Human Lysozyme AssayMax ELISA Kit

EL3020-1 96 Well Plate
EUR 396

Human HDHD2 AssayMax ELISA Kit

EH2429-1 96 Well Plate
EUR 477

Human HPRT1 AssayMax ELISA Kit

EH5337-1 96 Well Plate
EUR 477

Human HSD17B1 AssayMax ELISA Kit

EH7102-1 96 Well Plate
EUR 396

Human ICAT AssayMax ELISA Kit

EI3505-1 96 Well Plate
EUR 477

Human Albumin AssayMax ELISA Kit

EA2201-1 96 Well Plate
EUR 396

Human ADAMTS13 AssayMax ELISA Kit

EA2550-1 96 Well Plate
EUR 477

Human ALKBH3 AssayMax ELISA Kit

EA2622-1 96 Well Plate
EUR 417

Human Albumin AssayMax ELISA Kit

EA3201-1 96 Well Plate
EUR 417

Human CXCL7 AssayMax ELISA Kit

EC2270-1 96 Well Plate
EUR 477

Human CNDP2 AssayMax ELISA Kit

EC2505-1 96 Well Plate
EUR 417

Human CRYZ AssayMax ELISA Kit

EC2720-1 96 Well Plate
EUR 477

Human Calprotectin AssayMax ELISA Kit

EC3103-1 96 Well Plate
EUR 477

Human CCS AssayMax ELISA Kit

EC3105-1 96 Well Plate
EUR 417

Human Catalase AssayMax ELISA Kit

EC4208-1 96 Well Plate
EUR 477

Human AZGP1 AssayMax ELISA Kit

EA4728-1 96 Well Plate
EUR 477

Human AKR1B10 AssayMax ELISA Kit

EA5403-1 96 Well Plate
EUR 477

Human GOT2 AssayMax ELISA Kit

EA7652-1 96 Well Plate
EUR 477

Human Azurocidin AssayMax ELISA Kit

EA8121-1 96 Well Plate
EUR 477

Human ARL2BP AssayMax ELISA Kit

EA8710-1 96 Well Plate
EUR 417

Human B3GAT3 AssayMax ELISA Kit

EB3505-1 96 Well Plate
EUR 477

Human DDT AssayMax ELISA Kit

ED2527-1 96 Well Plate
EUR 477

Human ESM1 AssayMax ELISA Kit

EE3520-1 96 Well Plate
EUR 477

Human Hemopexin AssayMax ELISA Kit

EH1001-1 96 Well Plate
EUR 396

Human Haptoglobin AssayMax ELISA Kit

EH1003-1 96 Well Plate
EUR 396

Human Hemopexin AssayMax ELISA Kit

EH2001-1 96 Well Plate
EUR 396

Human Haptoglobin AssayMax ELISA Kit

EH2003-1 96 Well Plate
EUR 396

Human Ferritin AssayMax ELISA Kit

EF2003-1 96 Well Plate
EUR 396

Human GPIIbIIIa AssayMax ELISA Kit

EG1060-1 96 Well Plate
EUR 396

Human Ghrelin AssayMax ELISA Kit

EG3780-1 96 Well Plate
EUR 509

Human GARS AssayMax ELISA Kit

EG5133-1 96 Well Plate
EUR 477

Human Geminin AssayMax ELISA Kit

EG5701-1 96 Well Plate
EUR 477

Human GOT1 AssayMax ELISA Kit

EG7150-1 96 Well Plate
EUR 477

Human SAMD13 AssayMax ELISA Kit

ES3711-1 96 Well Plate
EUR 477

Human SH3GL3 AssayMax ELISA Kit

ES3880-1 96 Well Plate
EUR 477

Human KTN1(Kinectin 1) ELISA Kit