Human DOCK4(Dedicator Of Cytokinesis 4) ELISA Kit

Human DOCK4(Dedicator Of Cytokinesis 4) ELISA Kit

Human Dedicator Of Cytokinesis 4 (DOCK4) ELISA Kit
RD-DOCK4-Hu-96Tests 96 Tests
EUR 723
Dedicator of Cytokinesis 4 (DOCK4) Antibody
20-abx129252
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Dedicator Of Cytokinesis 4 (DOCK4) Antibody
20-abx172053
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Recombinant Dedicator Of Cytokinesis 4 (DOCK4)
4-RPG184Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8N1I0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Dedicator Of Cytokinesis 4 expressed in: E.coli
Human Dedicator Of Cytokinesis 4 (DOCK4) ELISA Kit
20-abx151336
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Dedicator Of Cytokinesis 4 (DOCK4) ELISA Kit
SEG184Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dedicator Of Cytokinesis 4 (DOCK4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dedicator Of Cytokinesis 4 (DOCK4) in Tissue homogenates and other biological fluids.
Human Dedicator Of Cytokinesis 4 (DOCK4) ELISA Kit
SEG184Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dedicator Of Cytokinesis 4 (DOCK4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dedicator Of Cytokinesis 4 (DOCK4) in Tissue homogenates and other biological fluids.
Human Dedicator Of Cytokinesis 4 (DOCK4) ELISA Kit
SEG184Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dedicator Of Cytokinesis 4 (DOCK4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dedicator Of Cytokinesis 4 (DOCK4) in Tissue homogenates and other biological fluids.
Human Dedicator Of Cytokinesis 4 (DOCK4) ELISA Kit
SEG184Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dedicator Of Cytokinesis 4 (DOCK4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dedicator Of Cytokinesis 4 (DOCK4) in Tissue homogenates and other biological fluids.
Human Dedicator Of Cytokinesis 4 (DOCK4) ELISA Kit
4-SEG184Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dedicator Of Cytokinesis 4 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dedicator Of Cytokinesis 4 (DOCK4) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Dedicator Of Cytokinesis 4 (DOCK4) Protein
20-abx168105
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Dedicator Of Cytokinesis 4 (DOCK4) CLIA Kit
20-abx495121
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Dedicator of cytokinesis protein 4, DOCK4 ELISA KIT
ELI-08843h 96 Tests
EUR 824
ELISA kit for Human DOCK4 (Dedicator Of Cytokinesis 4)
ELK4741 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dedicator Of Cytokinesis 4 (DOCK4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Dedicator Of Cytokinesis 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Dedicator Of Cytokinesis 4 (DOCK4) Polyclonal Antibody (Human)
4-PAG184Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK4 (Met1~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 4 (DOCK4)
Mouse Dedicator of cytokinesis protein 4, Dock4 ELISA KIT
ELI-26847m 96 Tests
EUR 865
ELISA kit for Human Dedicator of cytokinesis protein 4 (DOCK4)
KTE61990-48T 48T
EUR 332
  • Dock4 is part of a large class of proteins (GEFs) which contibrute to cellular signalling events by activating small G proteins. In their resting state G proteins are bound to Guanosine diphosphate (GDP) and their activation requires the dissociation
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dedicator of cytokinesis protein 4 (DOCK4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Dedicator of cytokinesis protein 4 (DOCK4)
KTE61990-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Dock4 is part of a large class of proteins (GEFs) which contibrute to cellular signalling events by activating small G proteins. In their resting state G proteins are bound to Guanosine diphosphate (GDP) and their activation requires the dissociation
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dedicator of cytokinesis protein 4 (DOCK4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Dedicator of cytokinesis protein 4 (DOCK4)
KTE61990-96T 96T
EUR 539
  • Dock4 is part of a large class of proteins (GEFs) which contibrute to cellular signalling events by activating small G proteins. In their resting state G proteins are bound to Guanosine diphosphate (GDP) and their activation requires the dissociation
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dedicator of cytokinesis protein 4 (DOCK4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Dedicator Of Cytokinesis 4 (DOCK4) Polyclonal Antibody (Human), APC
4-PAG184Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK4 (Met1~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 4 (DOCK4). This antibody is labeled with APC.
Dedicator Of Cytokinesis 4 (DOCK4) Polyclonal Antibody (Human), Biotinylated
4-PAG184Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK4 (Met1~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 4 (DOCK4). This antibody is labeled with Biotin.
Dedicator Of Cytokinesis 4 (DOCK4) Polyclonal Antibody (Human), Cy3
4-PAG184Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK4 (Met1~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 4 (DOCK4). This antibody is labeled with Cy3.
Dedicator Of Cytokinesis 4 (DOCK4) Polyclonal Antibody (Human), FITC
4-PAG184Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK4 (Met1~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 4 (DOCK4). This antibody is labeled with FITC.
Dedicator Of Cytokinesis 4 (DOCK4) Polyclonal Antibody (Human), HRP
4-PAG184Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK4 (Met1~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 4 (DOCK4). This antibody is labeled with HRP.
Dedicator Of Cytokinesis 4 (DOCK4) Polyclonal Antibody (Human), PE
4-PAG184Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK4 (Met1~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 4 (DOCK4). This antibody is labeled with PE.
Dedicator Of Cytokinesis 4 (DOCK4) Polyclonal Antibody (Human), APC-Cy7
4-PAG184Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK4 (Met1~Pro300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 4 (DOCK4). This antibody is labeled with APC-Cy7.
Human Dedicator Of Cytokinesis 3 (DOCK3) ELISA Kit
DLR-DOCK3-Hu-48T 48T
EUR 517
  • Should the Human Dedicator Of Cytokinesis 3 (DOCK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dedicator Of Cytokinesis 3 (DOCK3) in samples from tissue homogenates or other biological fluids.
Human Dedicator Of Cytokinesis 3 (DOCK3) ELISA Kit
DLR-DOCK3-Hu-96T 96T
EUR 673
  • Should the Human Dedicator Of Cytokinesis 3 (DOCK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dedicator Of Cytokinesis 3 (DOCK3) in samples from tissue homogenates or other biological fluids.
Human Dedicator Of Cytokinesis 3 (DOCK3) ELISA Kit
20-abx151335
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Dedicator Of Cytokinesis 3(DOCK3)ELISA Kit
QY-E04153 96T
EUR 361
Human Dedicator Of Cytokinesis 3 (DOCK3) ELISA Kit
RDR-DOCK3-Hu-48Tests 48 Tests
EUR 544
Human Dedicator Of Cytokinesis 3 (DOCK3) ELISA Kit
RDR-DOCK3-Hu-96Tests 96 Tests
EUR 756
Human Dedicator Of Cytokinesis 3 (DOCK3) ELISA Kit
RD-DOCK3-Hu-48Tests 48 Tests
EUR 521
Human Dedicator Of Cytokinesis 3 (DOCK3) ELISA Kit
RD-DOCK3-Hu-96Tests 96 Tests
EUR 723
Human Dedicator Of Cytokinesis 3 (DOCK3) ELISA Kit
SEG183Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dedicator Of Cytokinesis 3 (DOCK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dedicator Of Cytokinesis 3 (DOCK3) in Tissue homogenates and other biological fluids.
Human Dedicator Of Cytokinesis 3 (DOCK3) ELISA Kit
SEG183Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dedicator Of Cytokinesis 3 (DOCK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dedicator Of Cytokinesis 3 (DOCK3) in Tissue homogenates and other biological fluids.
Human Dedicator Of Cytokinesis 3 (DOCK3) ELISA Kit
SEG183Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dedicator Of Cytokinesis 3 (DOCK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dedicator Of Cytokinesis 3 (DOCK3) in Tissue homogenates and other biological fluids.
Human Dedicator Of Cytokinesis 3 (DOCK3) ELISA Kit
SEG183Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dedicator Of Cytokinesis 3 (DOCK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dedicator Of Cytokinesis 3 (DOCK3) in Tissue homogenates and other biological fluids.
Human Dedicator Of Cytokinesis 3 (DOCK3) ELISA Kit
4-SEG183Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dedicator Of Cytokinesis 3 elisa. Alternative names of the recognized antigen: MOCA
  • PBP
  • Modifier of cell adhesion
  • Presenilin-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dedicator Of Cytokinesis 3 (DOCK3) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Dedicator Of Cytokinesis 3 (DOCK3) Antibody
20-abx176110
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Dedicator Of Cytokinesis 1 (DOCK1) Antibody
20-abx211608
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dedicator of Cytokinesis 1 (DOCK1) Antibody
20-abx102732
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Dedicator of Cytokinesis 1 (DOCK1) Antibody
20-abx112009
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dedicator of Cytokinesis 2 (DOCK2) Antibody
20-abx112010
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dedicator of Cytokinesis 3 (DOCK3) Antibody
20-abx112011
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dedicator of Cytokinesis 2 (DOCK2) Antibody
20-abx126888
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Dedicator of Cytokinesis 2 (DOCK2) Antibody
20-abx129016
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Dedicator of Cytokinesis 1 (DOCK1) Antibody
abx147652-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Dedicator of Cytokinesis 2 (DOCK2) Antibody
20-abx149900
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dedicator Of Cytokinesis 3 (DOCK3) Antibody
20-abx172052
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Dedicator of Cytokinesis 1 (DOCK1) Antibody
20-abx014419
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Dedicator Of Cytokinesis 1 (DOCK1) Antibody
abx330938-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Dedicator Of Cytokinesis 2 (DOCK2) Antibody
20-abx326569
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dedicator Of Cytokinesis 1 (DOCK1) Antibody
20-abx325559
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dedicator Of Cytokinesis 1 (DOCK1) Antibody
20-abx333995
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dedicator of Cytokinesis 1 (DOCK1) Antibody
abx431929-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Dedicator of Cytokinesis 3 (DOCK3) Antibody
20-abx313603
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Recombinant Dedicator Of Cytokinesis 1 (DOCK1)
4-RPG175Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q14185
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Dedicator Of Cytokinesis 1 expressed in: E.coli
Recombinant Dedicator Of Cytokinesis 2 (DOCK2)
4-RPG182Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q92608
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.8kDa
  • Isoelectric Point: 9.2
Description: Recombinant Human Dedicator Of Cytokinesis 2 expressed in: E.coli
Human Dedicator Of Cytokinesis Protein 1 (DOCK1) ELISA Kit
abx259546-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Dedicator of cytokinesis protein 1, DOCK1 ELISA KIT
ELI-09218h 96 Tests
EUR 824
Human Dedicator of cytokinesis protein 5, DOCK5 ELISA KIT
ELI-09220h 96 Tests
EUR 824
Human Dedicator of cytokinesis protein 8, DOCK8 ELISA KIT
ELI-09221h 96 Tests
EUR 824
Human Dedicator of cytokinesis protein 6, DOCK6 ELISA KIT
ELI-26222h 96 Tests
EUR 824
Human Dedicator of cytokinesis protein 9, DOCK9 ELISA KIT
ELI-26223h 96 Tests
EUR 824
ELISA kit for Human DOCK3 (Dedicator Of Cytokinesis 3)
ELK3680 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dedicator Of Cytokinesis 3 (DOCK3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Dedicator Of Cytokinesis 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Dedicator Of Cytokinesis Protein 6 (DOCK6) ELISA Kit
abx386963-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Dedicator Of Cytokinesis Protein 7 (DOCK7) ELISA Kit
abx386964-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Dedicator Of Cytokinesis Protein 8 (DOCK8) ELISA Kit
abx386965-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Dedicator Of Cytokinesis Protein 9 (DOCK9) ELISA Kit
abx386966-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Dedicator of cytokinesis protein 7, DOCK7 ELISA KIT
ELI-31733h 96 Tests
EUR 824
Human Dedicator of cytokinesis protein 3, DOCK3 ELISA KIT
ELI-32143h 96 Tests
EUR 824
Human Dedicator of cytokinesis protein 11, DOCK11 ELISA KIT
ELI-46899h 96 Tests
EUR 824
Human Dedicator of cytokinesis protein 2, DOCK2 ELISA KIT
ELI-46901h 96 Tests
EUR 824
Human Dedicator of cytokinesis protein 10, DOCK10 ELISA KIT
ELI-47075h 96 Tests
EUR 824
Human Dedicator Of Cytokinesis 3 (DOCK3) CLIA Kit
20-abx495120
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Dedicator of cytokinesis protein 8 (DOCK8)
1-CSB-YP836734HU
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 21.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dedicator of cytokinesis protein 8(DOCK8),partial expressed in Yeast
Human Dedicator of cytokinesis protein 8 (DOCK8)
1-CSB-YP836734HUb0
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 21.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dedicator of cytokinesis protein 8(DOCK8),partial expressed in Yeast
Human Dedicator Of Cytokinesis 2 (DOCK2) Protein
20-abx166509
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Dedicator Of Cytokinesis 1 (DOCK1) Protein
20-abx066282
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Dedicator Of Cytokinesis 3 (DOCK3) Protein
20-abx653130
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse Dedicator of cytokinesis protein 3, Dock3 ELISA KIT
ELI-09219m 96 Tests
EUR 865
Mouse Dedicator of cytokinesis protein 8, Dock8 ELISA KIT
ELI-09684m 96 Tests
EUR 865
Mouse Dedicator of cytokinesis protein 9, Dock9 ELISA KIT
ELI-26224m 96 Tests
EUR 865
Mouse Dedicator of cytokinesis protein 5, Dock5 ELISA KIT
ELI-26848m 96 Tests
EUR 865
Mouse Dedicator of cytokinesis protein 11, Dock11 ELISA KIT
ELI-08041m 96 Tests
EUR 865
Mouse Dedicator of cytokinesis protein 10, Dock10 ELISA KIT
ELI-31732m 96 Tests
EUR 865
Mouse Dedicator of cytokinesis protein 7, Dock7 ELISA KIT
ELI-32144m 96 Tests
EUR 865
Mouse Dedicator of cytokinesis protein 6, Dock6 ELISA KIT
ELI-32830m 96 Tests
EUR 865
Mouse Dedicator of cytokinesis protein 1, Dock1 ELISA KIT
ELI-47076m 96 Tests
EUR 865
Mouse Dedicator of cytokinesis protein 2, Dock2 ELISA KIT
ELI-47799m 96 Tests
EUR 865
ELISA kit for Human Dedicator of cytokinesis protein 3 (DOCK3)
KTE61991-48T 48T
EUR 332
  • Dock3 was originally discovered in a screen for proteins that bind presenilin (a transmembrane protein which is mutated in early onset Alzheimer's disease).Dock3 is specifically expressed in neurones (primarily in the cerebral cortex and hippocampus)
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dedicator of cytokinesis protein 3 (DOCK3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Dedicator of cytokinesis protein 3 (DOCK3)
KTE61991-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Dock3 was originally discovered in a screen for proteins that bind presenilin (a transmembrane protein which is mutated in early onset Alzheimer's disease).Dock3 is specifically expressed in neurones (primarily in the cerebral cortex and hippocampus)
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dedicator of cytokinesis protein 3 (DOCK3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Dedicator of cytokinesis protein 3 (DOCK3)
KTE61991-96T 96T
EUR 539
  • Dock3 was originally discovered in a screen for proteins that bind presenilin (a transmembrane protein which is mutated in early onset Alzheimer's disease).Dock3 is specifically expressed in neurones (primarily in the cerebral cortex and hippocampus)
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dedicator of cytokinesis protein 3 (DOCK3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Mouse Dedicator of cytokinesis protein 8 (Dock8)
1-CSB-EP807451MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Dedicator of cytokinesis protein 8(Dock8),partial expressed in E.coli
Mouse Dedicator of cytokinesis protein 8 (Dock8)
1-CSB-EP807451MO1
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 24.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Dedicator of cytokinesis protein 8(Dock8),partial expressed in E.coli
Mouse Dedicator of cytokinesis protein 8 (Dock8)
1-CSB-YP807451MO1
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 21.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Dedicator of cytokinesis protein 8(Dock8),partial expressed in Yeast
Dedicator of Cytokinesis Protein 11 (DOCK11) Antibody
20-abx007957
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Dedicator of Cytokinesis Protein 11 (DOCK11) Antibody
20-abx219454
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dedicator of Cytokinesis Protein 5 (DOCK5) Antibody
abx122686-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Dedicator of Cytokinesis Protein 10 (DOCK10) Antibody
abx145342-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Dedicator Of Cytokinesis 1 (DOCK1) Antibody (HRP)
20-abx335295
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dedicator Of Cytokinesis 1 (DOCK1) Antibody (FITC)
20-abx335296
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dedicator Of Cytokinesis 1 (DOCK1) Antibody (Biotin)
20-abx335297
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dedicator of Cytokinesis Protein 10 (DOCK10) Antibody
20-abx301562
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dedicator of Cytokinesis Protein 5 (DOCK5) Antibody
20-abx311377
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dedicator of Cytokinesis 3 (DOCK3) Antibody (HRP)
20-abx313604
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dedicator of Cytokinesis 3 (DOCK3) Antibody (FITC)
20-abx313605
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dedicator of Cytokinesis 3 (DOCK3) Antibody (Biotin)
20-abx313606
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Recombinant mouse Dedicator of cytokinesis protein 8
P2375 100ug Ask for price
  • Uniprot ID: Q8C147
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for mouse Dedicator of cytokinesis protein 8
Dedicator Of Cytokinesis 1 (DOCK1) Polyclonal Antibody (Human)
4-PAG175Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK1 (Thr1200~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 1 (DOCK1)
Dedicator Of Cytokinesis 2 (DOCK2) Polyclonal Antibody (Human)
4-PAG182Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK2 (Ile390~Glu635)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 2 (DOCK2)
Dedicator Of Cytokinesis 1 (DOCK1) Polyclonal Antibody (Human), APC
4-PAG175Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK1 (Thr1200~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 1 (DOCK1). This antibody is labeled with APC.
Dedicator Of Cytokinesis 1 (DOCK1) Polyclonal Antibody (Human), Biotinylated
4-PAG175Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK1 (Thr1200~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 1 (DOCK1). This antibody is labeled with Biotin.
Dedicator Of Cytokinesis 1 (DOCK1) Polyclonal Antibody (Human), Cy3
4-PAG175Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK1 (Thr1200~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 1 (DOCK1). This antibody is labeled with Cy3.
Dedicator Of Cytokinesis 1 (DOCK1) Polyclonal Antibody (Human), FITC
4-PAG175Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK1 (Thr1200~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 1 (DOCK1). This antibody is labeled with FITC.
Dedicator Of Cytokinesis 1 (DOCK1) Polyclonal Antibody (Human), HRP
4-PAG175Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK1 (Thr1200~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 1 (DOCK1). This antibody is labeled with HRP.
Dedicator Of Cytokinesis 1 (DOCK1) Polyclonal Antibody (Human), PE
4-PAG175Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK1 (Thr1200~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 1 (DOCK1). This antibody is labeled with PE.
Dedicator Of Cytokinesis 2 (DOCK2) Polyclonal Antibody (Human), APC
4-PAG182Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK2 (Ile390~Glu635)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 2 (DOCK2). This antibody is labeled with APC.
Dedicator Of Cytokinesis 2 (DOCK2) Polyclonal Antibody (Human), Biotinylated
4-PAG182Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK2 (Ile390~Glu635)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 2 (DOCK2). This antibody is labeled with Biotin.
Dedicator Of Cytokinesis 2 (DOCK2) Polyclonal Antibody (Human), Cy3
4-PAG182Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK2 (Ile390~Glu635)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 2 (DOCK2). This antibody is labeled with Cy3.
Dedicator Of Cytokinesis 2 (DOCK2) Polyclonal Antibody (Human), FITC
4-PAG182Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK2 (Ile390~Glu635)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 2 (DOCK2). This antibody is labeled with FITC.
Dedicator Of Cytokinesis 2 (DOCK2) Polyclonal Antibody (Human), HRP
4-PAG182Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK2 (Ile390~Glu635)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 2 (DOCK2). This antibody is labeled with HRP.
Dedicator Of Cytokinesis 2 (DOCK2) Polyclonal Antibody (Human), PE
4-PAG182Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK2 (Ile390~Glu635)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 2 (DOCK2). This antibody is labeled with PE.
Dedicator Of Cytokinesis 1 (DOCK1) Polyclonal Antibody (Human), APC-Cy7
4-PAG175Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK1 (Thr1200~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 1 (DOCK1). This antibody is labeled with APC-Cy7.
Dedicator Of Cytokinesis 2 (DOCK2) Polyclonal Antibody (Human), APC-Cy7
4-PAG182Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DOCK2 (Ile390~Glu635)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dedicator Of Cytokinesis 2 (DOCK2). This antibody is labeled with APC-Cy7.
DOCK4 ELISA KIT|Human
EF009193 96 Tests
EUR 689
Human Protein regulator of cytokinesis 1, PRC1 ELISA KIT
ELI-22266h 96 Tests
EUR 824
Human Protein regulator of cytokinesis 1 (PRC1) ELISA Kit
abx382447-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
DOCK4 ELISA Kit (Human) (OKCD00492)
OKCD00492 96 Wells
EUR 831
Description: Description of target: Involved in regulation of adherens junction between cells. Plays a role in cell migration. Functions as a guanine nucleotide exchange factor (GEF), which activates Rap1 small GTPase by exchanging bound GDP for free GTP.2 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"DOCK4, a GTPase activator, is disrupted during tumorigenesis."_x005F_x005F_x000D_Yajnik V., Paulding C., Sordella R., McClatchey A.I., Saito M., Wahrer D.C.R., Reynolds P., Bell D.W., Lake R., van den Heuvel S., Settleman J., Haber D.A._x005F_x005F_x000D_Cell 112:673-684(2003) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), FUNCTION, SUBCELLULAR LOCATION, TISSUE SPECIFICITY, INTERACTION WITH CRK, RAP1 ACTIVATION, VARIANTS ILE-87; GLN-606; THR-1059; LEU-1718; ALA-1733; PRO-1755; MET-1884; ILE-1914; LEU-1917 AND LEU-1926.Ref.10"Ephexin4 and EphA2 mediate cell migration through a RhoG-dependent mechanism."_x005F_x005F_x000D_Hiramoto-Yamaki N., Takeuchi S., Ueda S., Harada K., Fujimoto S., Negishi M., Katoh H._x005F_x005F_x000D_J. Cell Biol. 190:461-477(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH ELMO2 AND EPHA2, SUBCELLULAR LOCATION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL
DOCK4 ELISA Kit (Human) (OKDD00238)
OKDD00238 96 Wells
EUR 975
Description: Description of target: This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.063 ng/mL
Docking Protein 4 (DOCK4) Antibody
abx232495-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Mouse Protein regulator of cytokinesis 1, Prc1 ELISA KIT
ELI-15432m 96 Tests
EUR 865
Mouse Protein regulator of cytokinesis 1 (PRC1) ELISA Kit
abx390341-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Prc1 ELISA Kit| Mouse Protein regulator of cytokinesis 1 ELISA
EF015982 96 Tests
EUR 689
Protein Regulator of Cytokinesis 1 (PRC1) Antibody
20-abx006417
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein regulator of cytokinesis 1 (PRC1) Antibody
20-abx212926
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein Regulator of Cytokinesis 1 (PRC1) Antibody
20-abx114861
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein Regulator of Cytokinesis 1 (PRC1) Antibody
abx036162-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Protein Regulator of Cytokinesis 1 (PRC1) Antibody
20-abx142167
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein Regulator of Cytokinesis 1 (PRC1) Antibody
abx236748-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Protein Regulator of Cytokinesis 1 (PRC1) Antibody
abx236749-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Protein regulator of cytokinesis 1 (PRC1) Antibody
20-abx325006
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
DOCK4 Antibody
48522-100ul 100ul
EUR 333
DOCK4 Antibody
48522-50ul 50ul
EUR 239
DOCK4 siRNA
20-abx914483
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DOCK4 siRNA
20-abx914484
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-DOCK4
YF-PA25401 50 ul
EUR 334
Description: Mouse polyclonal to DOCK4
IL-4 Interleukin 4 Human Recombinant Protein, Yeast
PROTP05112-4 Regular: 10ug
EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.
Human DOCK4 shRNA Plasmid
20-abx956500
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Human Cluster of Differentiation 4 ELISA kit
E01C0004-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cluster of Differentiation 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cluster of Differentiation 4 ELISA kit
E01C0004-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cluster of Differentiation 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cluster of Differentiation 4 ELISA kit
E01C0004-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cluster of Differentiation 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-48T 48T
EUR 479
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
DLR-CA72-4-Hu-96T 96T
EUR 621
  • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-48Tests 48 Tests
EUR 500
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RDR-CA72-4-Hu-96Tests 96 Tests
EUR 692
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-48Tests 48 Tests
EUR 478
Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit
RD-CA72-4-Hu-96Tests 96 Tests
EUR 662
DOCK4 Rabbit pAb
A15764-100ul 100 ul
EUR 308
DOCK4 Rabbit pAb
A15764-200ul 200 ul
EUR 459
DOCK4 Rabbit pAb
A15764-20ul 20 ul
EUR 183
DOCK4 Rabbit pAb
A15764-50ul 50 ul
EUR 223
DOCK4 Conjugated Antibody
C48522 100ul
EUR 397
DOCK4 cloning plasmid
CSB-CL854021HU-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 6036
  • Sequence: ATGTGGATACCTACGGAGCACGAGAAATACGGCGTGGTTATTGCCAGTTTCCGAGGAACCGTTCCATATGGCCTGTCATTGGAAATTGGAGATACAGTTCAGATCCTGGAGAAGTGTGATGGCTGGTACAGAGGATTTGCCTTAAAAAACCCAAATATCAAGGGTATATTTCCTT
  • Show more
Description: A cloning plasmid for the DOCK4 gene.
anti- DOCK4 antibody
FNab02495 100µg
EUR 585
  • Immunogen: dedicator of cytokinesis 4
  • Uniprot ID: Q8N1I0
  • Gene ID: 9732
  • Research Area: Signal Transduction
Description: Antibody raised against DOCK4
Anti-DOCK4 antibody
PAab02495 100 ug
EUR 412
Anti-DOCK4 antibody
STJ118223 100 µl
EUR 277
Anti-DOCK4 (3E7)
YF-MA11202 50 ug
EUR 363
Description: Mouse monoclonal to DOCK4
Anti-DOCK4 (3E7)
YF-MA16990 200 ul
EUR 363
Description: Mouse monoclonal to DOCK4
Anti-DOCK4 (1B3)
YF-MA16991 100 ug
EUR 363
Description: Mouse monoclonal to DOCK4
Human tissue inhibitors of metalloproteinase 4,TIMP-4 ELISA Kit
201-12-1245 96 tests
EUR 440
  • This tissue inhibitors of metalloproteinase 4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human tissue inhibitors of metalloproteinase 4, TIMP-4 ELISA Kit
CSB-E04735h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human tissue inhibitors of metalloproteinase 4, TIMP-4 in samples from serum, plasma, tissue homogenates, humanmilk. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human tissue inhibitors of metalloproteinase 4, TIMP-4 ELISA Kit
1-CSB-E04735h
  • EUR 556.00
  • EUR 3862.00
  • EUR 2060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human tissue inhibitors of metalloproteinase 4, TIMP-4 in samples from serum, plasma, tissue homogenates, humanmilk. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human tissue inhibitors of metalloproteinase 4,TIMP-4 ELISA Kit
CN-03280H1 96T
EUR 461
Human tissue inhibitors of metalloproteinase 4,TIMP-4 ELISA Kit
CN-03280H2 48T
EUR 310
Human tissue inhibitors of metalloproteinase 4(TIMP-4)ELISA Kit
GA-E1261HM-48T 48T
EUR 289
Human tissue inhibitors of metalloproteinase 4(TIMP-4)ELISA Kit
GA-E1261HM-96T 96T
EUR 466
Human tissue inhibitors of metalloproteinase 4(TIMP-4)ELISA Kit
QY-E02974 96T
EUR 361
Human FibrOut 4, for brain, neural
4-21552 1 ml Ask for price
Human FibrOut 4, for brain, neural
4-21553 5 x 1 ml Ask for price
Recombinant Human 4-1BB Receptor Protein
PROTQ07011-4 20ug
EUR 317
Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor.
Recombinant Human PF-4 (CXCL4) Protein
PROTP02776-4 20ug
EUR 317
Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines.
DOCK4 ORF Vector (Human) (pORF)
ORF012869 1.0 ug DNA
EUR 354
Human Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Hu-48T 48T
EUR 498
  • Should the Human Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 4 (CD4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Cluster Of Differentiation 4 (CD4) ELISA Kit
DLR-CD4-Hu-96T 96T
EUR 647
  • Should the Human Cluster Of Differentiation 4 (CD4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 4 (CD4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Tissue inhibitors of metalloproteinase 4 ELISA kit
E01T0519-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Tissue inhibitors of metalloproteinase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tissue inhibitors of metalloproteinase 4 ELISA kit
E01T0519-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Tissue inhibitors of metalloproteinase 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DOCK4(Dedicator Of Cytokinesis 4) ELISA Kit