Skip to content
Theragen Bio

Research Data

  • Home
  • Western Blot Reagents
  • Body’s bugs to be sequenced
  • Our products
  • Home
  • Western Blot Reagents
  • Body’s bugs to be sequenced
  • Our products

Human SRI(Sorcin) ELISA Kit

  • Home
  • Human SRI(Sorcin) ELISA Kit

Human SRI(Sorcin) ELISA Kit

Human Sorcin (SRI)ELISA Kit

201-12-2543 SunredBio 96 tests
EUR 440
  • This Sorcin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Sorcin(SRI)ELISA Kit

QY-E02519 Qayee Biotechnology 96T
EUR 361

Human Sorcin (SRI) ELISA Kit

SEH133Hu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.

Human Sorcin (SRI) ELISA Kit

SEH133Hu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.

Human Sorcin (SRI) ELISA Kit

SEH133Hu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.

Human Sorcin (SRI) ELISA Kit

SEH133Hu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.

Human Sorcin (SRI) ELISA Kit

4-SEH133Hu Cloud-Clone
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sorcin elisa. Alternative names of the recognized antigen: SCN
  • CP-22
  • V19
  • 22 kDa protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sorcin (SRI) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Sorcin (SRI) ELISA Kit

abx555639-96tests Abbexa 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Sri/ Sorcin ELISA Kit

E1413Mo Sunlong 1 Kit
EUR 632

Mouse Sorcin, Sri ELISA KIT

ELI-53405m Lifescience Market 96 Tests
EUR 865

Sorcin (SRI) Antibody

20-abx115730 Abbexa
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sorcin (SRI) Antibody

20-abx131566 Abbexa
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sorcin (SRI) Antibody

20-abx141905 Abbexa
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sorcin (SRI) Antibody

20-abx006837 Abbexa
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sorcin (SRI) Antibody

20-abx174604 Abbexa
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sorcin (SRI) Antibody

20-abx322137 Abbexa
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sorcin (SRI) Protein

20-abx261147 Abbexa
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Sorcin (SRI) Antibody

abx238228-100ug Abbexa 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Sorcin (SRI)

4-RPH133Hu01 Cloud-Clone
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P30626
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Sorcin expressed in: E.coli

ELISA kit for Human SRI (Sorcin)

ELK5034 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sorcin (SRI). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sorcin (SRI). Next, A
  • Show more
Description: A sandwich ELISA kit for detection of Sorcin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Sorcin (SRI)

KTE60358-48T Abbkine 48T
EUR 332
  • The 22-kD sorcin protein was overexpressed in HOB1/VCR-1.0 cells, a multidrug-resistant human B immunoblastic lymphoma cell line. By PCR with primers based on the sequence of hamster sorcin, the authors recovered a partial human sorcin cDNA. Using th
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sorcin (SRI)

KTE60358-5platesof96wells Abbkine 5 plates of 96 wells
EUR 2115
  • The 22-kD sorcin protein was overexpressed in HOB1/VCR-1.0 cells, a multidrug-resistant human B immunoblastic lymphoma cell line. By PCR with primers based on the sequence of hamster sorcin, the authors recovered a partial human sorcin cDNA. Using th
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sorcin (SRI)

KTE60358-96T Abbkine 96T
EUR 539
  • The 22-kD sorcin protein was overexpressed in HOB1/VCR-1.0 cells, a multidrug-resistant human B immunoblastic lymphoma cell line. By PCR with primers based on the sequence of hamster sorcin, the authors recovered a partial human sorcin cDNA. Using th
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Sorcin (SRI) CLIA Kit

20-abx495378 Abbexa
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Sorcin (SRI) Protein

20-abx650707 Abbexa
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Mouse Sorcin (SRI)

KTE70255-48T Abbkine 48T
EUR 332
  • Sarcalumenin is a gene which encodes a 160-kD glycoprotein protein involved in calcium signaling.Muscle contraction is triggered by the release of calcium from the sarcoplasmic reticulum, whereas muscle relaxation is achieved by rapid reuptake of cal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sorcin (SRI)

KTE70255-5platesof96wells Abbkine 5 plates of 96 wells
EUR 2115
  • Sarcalumenin is a gene which encodes a 160-kD glycoprotein protein involved in calcium signaling.Muscle contraction is triggered by the release of calcium from the sarcoplasmic reticulum, whereas muscle relaxation is achieved by rapid reuptake of cal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sorcin (SRI)

KTE70255-96T Abbkine 96T
EUR 539
  • Sarcalumenin is a gene which encodes a 160-kD glycoprotein protein involved in calcium signaling.Muscle contraction is triggered by the release of calcium from the sarcoplasmic reticulum, whereas muscle relaxation is achieved by rapid reuptake of cal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Sri ELISA Kit| Mouse Sorcin ELISA Kit

EF016248 Lifescience Market 96 Tests
EUR 689

SRI Sorcin Human Recombinant Protein

PROTP30626 BosterBio Regular: 20ug
EUR 317
Description: SRI Human Recombinant fused with a 23 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 221 amino acids (1-198 a.a.) and having a molecular mass of 24.1kDa. The SRI is purified by proprietary chromatographic techniques.

Sorcin (SRI) Polyclonal Antibody (Human)

4-PAH133Hu01 Cloud-Clone
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI)

Sorcin (SRI) Polyclonal Antibody (Human), APC

4-PAH133Hu01-APC Cloud-Clone
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with APC.

Sorcin (SRI) Polyclonal Antibody (Human), Biotinylated

4-PAH133Hu01-Biotin Cloud-Clone
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with Biotin.

Sorcin (SRI) Polyclonal Antibody (Human), Cy3

4-PAH133Hu01-Cy3 Cloud-Clone
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with Cy3.

Sorcin (SRI) Polyclonal Antibody (Human), FITC

4-PAH133Hu01-FITC Cloud-Clone
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with FITC.

Sorcin (SRI) Polyclonal Antibody (Human), HRP

4-PAH133Hu01-HRP Cloud-Clone
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with HRP.

Sorcin (SRI) Polyclonal Antibody (Human), PE

4-PAH133Hu01-PE Cloud-Clone
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with PE.

Polyclonal SRI / Sorcin Antibody (aa50-100)

APR02437G Leading Biology 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SRI / Sorcin (aa50-100). This antibody is tested and proven to work in the following applications:

Sorcin (SRI) Polyclonal Antibody (Human), APC-Cy7

4-PAH133Hu01-APC-Cy7 Cloud-Clone
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SRI (Gly29~Leu169)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with APC-Cy7.

Recombinant Human SRI/ Sorcin Protein, GST, E.coli-100ug

QP6727-ec-100ug EnQuireBio 100ug
EUR 408

Recombinant Human SRI/ Sorcin Protein, GST, E.coli-10ug

QP6727-ec-10ug EnQuireBio 10ug
EUR 200

Recombinant Human SRI/ Sorcin Protein, GST, E.coli-1mg

QP6727-ec-1mg EnQuireBio 1mg
EUR 1632

Recombinant Human SRI/ Sorcin Protein, GST, E.coli-200ug

QP6727-ec-200ug EnQuireBio 200ug
EUR 634

Recombinant Human SRI/ Sorcin Protein, GST, E.coli-500ug

QP6727-ec-500ug EnQuireBio 500ug
EUR 1060

Recombinant Human SRI/ Sorcin Protein, GST, E.coli-50ug

QP6727-ec-50ug EnQuireBio 50ug
EUR 263

SRI ELISA KIT|Human

EF003232 Lifescience Market 96 Tests
EUR 689

ELISA kit for Human Sorcin

EK3730 SAB 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sorcin in samples from serum, plasma, tissue homogenates and other biological fluids.

SRI ELISA Kit (Human) (OKCD01022)

OKCD01022 Aviva Systems Biology 96 Wells
EUR 831
Description: Description of target: Calcium-binding protein that modulates excitation-contraction coupling in the heart. Contributes to calcium homeostasis in the heart sarcoplasmic reticulum. Modulates the activity of RYR2 calcium channels.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.16"Molecular basis for the impaired function of the natural F112L sorcin mutant: X-ray crystal structure, calcium affinity, and interaction with annexin VII and the ryanodine receptor."_x005F_x005F_x000D_Franceschini S., Ilari A., Verzili D., Zamparelli C., Antaramian A., Rueda A., Valdivia H.H., Chiancone E., Colotti G._x005F_x005F_x000D_FASEB J. 22:295-306(2008) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.5 ANGSTROMS) OF MUTANT LEU-112, SUBUNIT, FUNCTION, CALCIUM-BINDING, INTERACTION WITH RYR2 AND ANXA7. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.119 ng/mL

SRI ELISA Kit (Human) (OKEH03543)

OKEH03543 Aviva Systems Biology 96 Wells
EUR 779
Description: Description of target: Calcium-binding protein that modulates excitation-contraction coupling in the heart. Contributes to calcium homeostasis in the heart sarcoplasmic reticulum. Modulates the activity of RYR2 calcium channels.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.176 ng/mL

ELISA kit for Mouse Sorcin

EK3729 SAB 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Sorcin in samples from serum, plasma, tissue homogenates and other biological fluids.

Recombinant Human Sorcin

7-06526 CHI Scientific 5µg Ask for price

Recombinant Human Sorcin

7-06527 CHI Scientific 20µg Ask for price

Recombinant Human Sorcin

7-06528 CHI Scientific 1mg Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 Alpha Diagnostics 1
EUR 202

SRI antibody

70R-20520 Fitzgerald 50 ul
EUR 435
Description: Rabbit polyclonal SRI antibody

SRI siRNA

20-abx935158 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SRI siRNA

20-abx935159 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SRI Antibody

1-CSB-PA022665ESR1HU Cusabio
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SRI. Recognizes SRI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

SRI Antibody

1-CSB-PA022665GA01HU Cusabio
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SRI. Recognizes SRI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Human SRI shRNA Plasmid

20-abx954586 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SRI Recombinant Protein (Human)

RP030076 ABM 100 ug Ask for price

SRI cloning plasmid

CSB-CL022665HU-10ug Cusabio 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 597
  • Sequence: atggcgtacccggggcatcctggcgccggcggcgggtactacccaggcgggtatggaggggctcccggagggcctgcgtttcccggacaaactcaggatccgctgtatggttactttgctgctgtagctggacaggatgggcagatagatgctgatgaattgcagagatgtctgac
  • Show more
Description: A cloning plasmid for the SRI gene.

SRI-011381 (hydrochloride)

HY-100347A MedChemExpress 50mg
EUR 1097

SRI 31215 (TFA)

HY-114363A MedChemExpress 100mg
EUR 1887

anti- SRI antibody

FNab08228 FN Test 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: sorcin
  • Uniprot ID: P30626
  • Gene ID: 6717
  • Research Area: Neuroscience, Cardiovascular, Signal Transduction
Description: Antibody raised against SRI

Anti-SRI Antibody

A00222 BosterBio 100ug/vial
EUR 334

SRI Rabbit pAb

A6751-100ul Abclonal 100 ul
EUR 308

SRI Rabbit pAb

A6751-200ul Abclonal 200 ul
EUR 459

SRI Rabbit pAb

A6751-20ul Abclonal 20 ul
EUR 183

SRI Rabbit pAb

A6751-50ul Abclonal 50 ul
EUR 223

SRI Polyclonal Antibody

42331-100ul SAB 100ul
EUR 333

Anti-SRI antibody

PAab08228 Lifescience Market 100 ug
EUR 386

Anti-SRI antibody

STJ28834 St John's Laboratory 100 µl
EUR 277
Description: This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene.

Anti-SRI antibody

STJ11100797 St John's Laboratory 100 µl
EUR 413
Description: This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene.

SRI ORF Vector (Human) (pORF)

ORF010026 ABM 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT Next Advance 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT Next Advance 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

SRI Polyclonal Conjugated Antibody

C42331 SAB 100ul
EUR 397

Human SRI(Sorcin) ELISA Kit

Recent Posts
  • ANTIBODY FINDER, PROTEINS AND ELISA KITS
  • QPCR Troubleshooting Guide
  • An up-to-date review on bio-resource therapeutics effective against bacterial species frequently associated with chronic sinusitis and tonsillitis
  • Bio-Fabrication: Convergence of 3D Bioprinting and Nano-Biomaterials in Tissue Engineering and Regenerative Medicine
  • Recognition of Patient Groups with Sleep Related Disorders using Bio-signal Processing and Deep Learning
Categories
  • An up-to-date review on bio-resource therapeutics effective against bacterial species frequently associated with chronic sinusitis and tonsillitis.
  • Bio-chemo-electro-mechanical modelling of the rapid movement of Mimosa pudica
  • Bio-Fabrication: Convergence of 3D Bioprinting and Nano-Biomaterials in Tissue Engineering and Regenerative Medicine
  • Exploring the additive bio-agent impacts upon ectoine production by Halomonas salina DSM5928T using corn steep liquor and soybean hydrolysate as nutrient supplement
  • Recognition of Patient Groups with Sleep Related Disorders using Bio-signal Processing and Deep Learning
  • Uncategorized

© 2019 All Right Reserved | Arowana WordPress Theme