Human EDN2(Endothelin 2) ELISA Kit

Human EDN2(Endothelin 2) ELISA Kit

Human Endothelin 2 (EDN2) ELISA Kit
RDR-EDN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 665

Human Endothelin 2 (EDN2) ELISA Kit
RD-EDN2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 460

Human Endothelin 2 (EDN2) ELISA Kit
RD-EDN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 636

Rat Endothelin 2 (EDN2) ELISA Kit
DLR-EDN2-Ra-48T	DL Develop	48T	EUR 495
Should the Rat Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Endothelin 2 (EDN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit
DLR-EDN2-Ra-96T	DL Develop	96T	EUR 644
Should the Rat Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Endothelin 2 (EDN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit
RDR-EDN2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 519

Rat Endothelin 2 (EDN2) ELISA Kit
RDR-EDN2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 720

Rat Endothelin 2 (EDN2) ELISA Kit
RD-EDN2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 496

Rat Endothelin 2 (EDN2) ELISA Kit
RD-EDN2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 688

Human Endothelin 2 (EDN2) ELISA Kit
CEF415Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit
CEF415Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit
CEF415Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit
CEF415Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit
4-CEF415Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Endothelin 2 elisa. Alternative names of the recognized antigen: ET2 PPET2 Preproendothelin-2
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Endothelin 2 (EDN2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Endothelin 2 (EDN2) ELISA Kit
abx576570-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human EDN2/ Endothelin-2 ELISA Kit
E0758Hu	Sunlong	1 Kit	EUR 571

Human EDN2(Endothelin-2) ELISA Kit
EH2114	FN Test	96T	EUR 567.6
Detection range: 0.781-50 pg/ml Uniprot ID: P20800 Alias: ET-2/Preproendothelin-2(PPET2)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469pg/ml

Human Endothelin- 2, EDN2 ELISA KIT
ELI-06811h	Lifescience Market	96 Tests	EUR 824

Human Endothelin 2 (EDN2) ELISA Kit
20-abx156808	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Endothelin-2(EDN2)ELISA Kit
CSB-E16518h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-2 (EDN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Endothelin-2(EDN2)ELISA Kit
1-CSB-E16518h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-2(EDN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Endothelin 2 (EDN2) ELISA Kit
CEF415Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit
CEF415Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit
CEF415Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit
CEF415Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit
4-CEF415Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Endothelin 2 elisa. Alternative names of the recognized antigen: ET2 PPET2 Preproendothelin-2
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Endothelin 2 (EDN2) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Cow Endothelin 2 (EDN2) ELISA Kit
abx519466-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Dog Endothelin 2 (EDN2) ELISA Kit
abx519467-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Endothelin 2 (EDN2) ELISA Kit
abx575853-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Edn2/ Endothelin-2 ELISA Kit
E1635Mo	Sunlong	1 Kit	EUR 571

Bovine Endothelin- 2, EDN2 ELISA KIT
ELI-06807b	Lifescience Market	96 Tests	EUR 928

Rabbit Endothelin- 2, EDN2 ELISA KIT
ELI-06808Ra	Lifescience Market	96 Tests	EUR 928

Mouse Endothelin- 2, Edn2 ELISA KIT
ELI-06809m	Lifescience Market	96 Tests	EUR 865

Mouse Edn2(Endothelin-2) ELISA Kit
EM0727	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: P22389 Alias: Edn2/ET-2/Preproendothelin-2(PPET2)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml

Rat Endothelin 2 (EDN2) ELISA Kit
20-abx155474	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Endothelin 2 (EDN2) ELISA Kit
abx255075-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Endothelin-2(EDN2) ELISA kit
CSB-EL007401MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Endothelin-2 (EDN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Endothelin-2(EDN2) ELISA kit
1-CSB-EL007401MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Endothelin-2(EDN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human EDN2 (Endothelin 2)
ELK5069	ELK Biotech	1 plate of 96 wells	EUR 432
A monoclonal antibody specific to Endothelin 2 (EDN2) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Endothelin 2 (EDN2) and unlabeled Endothelin 2 (EDN2) (Standards or samples) with the pr Show more
Description: A competitive Inhibition ELISA kit for detection of Endothelin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Endothelin-2 (EDN2)
KTE61953-48T	Abbkine	48T	EUR 332
Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Endothelin-2 (EDN2)
KTE61953-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Endothelin-2 (EDN2)
KTE61953-96T	Abbkine	96T	EUR 539
Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Endothelin 2 (EDN2) CLIA Kit
20-abx490518	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Endothelin 2 (EDN2) Antibody
20-abx112293	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody
20-abx128276	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Endothelin 2 (EDN2) Antibody
abx027651-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody
abx027651-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody
20-abx172237	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Endothelin 2 (EDN2) Antibody
20-abx172238	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Endothelin 2 (EDN2) Antibody
20-abx176270	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Endothelin 2 (EDN2) Protein
20-abx260088	Abbexa	EUR 328.00 EUR 2736.00 EUR 787.00	1 mg 25 mg 5 mg
Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody
20-abx339841	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody
20-abx210820	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody
20-abx211230	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Endothelin 2 (EDN2)
4-RPF415Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P20800 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 20.5kDa Isoelectric Point: Inquire
Description: Recombinant Human Endothelin 2 expressed in: E.coli

Human Endothelin 2 (EDN2) Protein
20-abx166607	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

EDN2 Human Endothelin-2 protein
PROTP20800-1	BosterBio	Regular: 5mg	EUR 697
Description: EDN2 contains 21 amino acids having a molecular mass of 2546.97 Dalton.

ELISA kit for Rat EDN2 (Endothelin 2)
ELK6274	ELK Biotech	1 plate of 96 wells	EUR 432
A monoclonal antibody specific to Endothelin 2 (EDN2) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Endothelin 2 (EDN2) and unlabeled Endothelin 2 (EDN2) (Standards or samples) with the pr Show more
Description: A competitive Inhibition ELISA kit for detection of Endothelin 2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Edn2 ELISA Kit| Mouse Endothelin-2 ELISA Kit
EF013338	Lifescience Market	96 Tests	EUR 689

Rat Endothelin 2 (EDN2) CLIA Kit
20-abx490519	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Endothelin 2 (EDN2) Protein
20-abx653272	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Endothelin 2 (EDN2) Polyclonal Antibody (Human)
4-PAF415Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDN2 (Gln32~Arg178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2)

Endothelin 2 (EDN2) Polyclonal Antibody (Human), APC
4-PAF415Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDN2 (Gln32~Arg178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with APC.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), Biotinylated
4-PAF415Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDN2 (Gln32~Arg178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with Biotin.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), Cy3
4-PAF415Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDN2 (Gln32~Arg178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with Cy3.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), FITC
4-PAF415Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDN2 (Gln32~Arg178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with FITC.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), HRP
4-PAF415Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDN2 (Gln32~Arg178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with HRP.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), PE
4-PAF415Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDN2 (Gln32~Arg178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with PE.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), APC-Cy7
4-PAF415Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDN2 (Gln32~Arg178) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with APC-Cy7.

EDN2 Human, Endothelin-2 Human Recombinant Protein, His Tag
PROTP20800	BosterBio	Regular: 20ug	EUR 317
Description: EDN2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 177 amino acids (25-178 a.a.) and having a molecular mass of 19.9kDa. EDN2 is fused to a 23 amino acid His-tag at N-terminus.

ET-2/EDN2/ Rat ET- 2/ EDN2 ELISA Kit
ELA-E14916r	Lifescience Market	96 Tests	EUR 886

Edn2/ Rat Edn2 ELISA Kit
ELI-06810r	Lifescience Market	96 Tests	EUR 886

Human EDN2 ELISA Kit
ELA-E2118h	Lifescience Market	96 Tests	EUR 824

EDN2 ELISA KIT|Human
EF006192	Lifescience Market	96 Tests	EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

ELISA kit for Human Endothelin-2
EK4305	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Endothelin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Canine EDN2 ELISA KIT
ELI-06806d	Lifescience Market	96 Tests	EUR 928

Endothelin-2, human
HY-P0207	MedChemExpress	500ug	EUR 349

Human Endothelin-2
7-02164	CHI Scientific	1mg	Ask for price

Human Endothelin-2
7-02165	CHI Scientific	5mg	Ask for price

Human Endothelin-2
7-02166	CHI Scientific	25mg	Ask for price

Human Endothelin ELISA Kit
LF-EK50969	Abfrontier	1×96T	EUR 648

EDN2 ELISA Kit (Rat) (OKCD02399)
OKCD02399	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: Vasoconstrictor. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive Inhibition ELISA;Sensitivity: < 2.67 pg/mL

EDN2 ELISA Kit (Mouse) (OKEH01507)
OKEH01507	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a member of the endothelin family of peptides. The encoded preproprotein undergoes proteolytic processing to generate a potent vasoconstrictive peptide. This gene is abundantly expressed in the gastrointestinal tract, strongly induced in photorecepteror cells in retinal diseases and injury, and produced by microglia and macrophages in the early stages of glaucoma. Mice lacking the encoded protein exhibit severe growth retardation, hypothermia and juvenile lethality.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.044 ng/mL

EDN2 ELISA Kit (Rat) (OKEH06451)
OKEH06451	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Vasoconstrictor. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 42.3 pg/mL

ELISA kit for Mouse Endothelin-2
EK4304	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Endothelin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

EDN2 ELISA Kit (Human) : 96 Wells (OKEH00573)
OKEH00573	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Endothelins are endothelium-derived vasoconstrictor peptides.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL

Big Endothelin-2 (human)
H-7566.0100	Bachem	0.1mg	EUR 271
Description: Sum Formula: C194H281N49O57S4; CAS# [151853-67-7] net

Endothelin-2 (human, canine)
H-7768.0500	Bachem	0.5mg	EUR 248
Description: Sum Formula: C115H160N26O32S4; CAS# [123562-20-9] net

Endothelin-2 (human, canine)
H-7768.1000	Bachem	1.0mg	EUR 383
Description: Sum Formula: C115H160N26O32S4; CAS# [123562-20-9] net

Endothelin-2 (human, canine)
H-9020.0500	Bachem	0.5mg	EUR 576
Description: Sum Formula: C115H160N26O32S4; CAS# [123562-20-9] net

Endothelin-2 (human, canine)
H-9020.1000	Bachem	1.0mg	EUR 998
Description: Sum Formula: C115H160N26O32S4; CAS# [123562-20-9] net

Endothelin 2 (human, canine)
5-01099	CHI Scientific	0.4 x 5mg	Ask for price

Human Endothelin-2 Antibody
10811-05011	AssayPro	150 ug	EUR 217

Human Endothelin-2 Antibody
32148-05111	AssayPro	150 ug	EUR 261

Human Endothelin Converting Enzyme 2 (ECE2) ELISA Kit
CEF414Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin Converting Enzyme 2 (ECE2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin Converting Enzyme 2 (ECE2) in Tissue homogenates, cell lysates and other biological fluids.

Human Endothelin Converting Enzyme 2 (ECE2) ELISA Kit
CEF414Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin Converting Enzyme 2 (ECE2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin Converting Enzyme 2 (ECE2) in Tissue homogenates, cell lysates and other biological fluids.

Human Endothelin Converting Enzyme 2 (ECE2) ELISA Kit
CEF414Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin Converting Enzyme 2 (ECE2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin Converting Enzyme 2 (ECE2) in Tissue homogenates, cell lysates and other biological fluids.

Human Endothelin Converting Enzyme 2 (ECE2) ELISA Kit
CEF414Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin Converting Enzyme 2 (ECE2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin Converting Enzyme 2 (ECE2) in Tissue homogenates, cell lysates and other biological fluids.

Human Endothelin Converting Enzyme 2 (ECE2) ELISA Kit
4-CEF414Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Endothelin Converting Enzyme 2 elisa. Alternative names of the recognized antigen: Methyltransferase-like region
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Endothelin Converting Enzyme 2 (ECE2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Endothelin- converting enzyme 2, ECE2 ELISA KIT
ELI-47594h	Lifescience Market	96 Tests	EUR 824

Human Endothelin Converting Enzyme 2 (ECE2) ELISA Kit
20-abx156818	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Endothelin 1 ELISA kit
E01E0040-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin 1 ELISA kit
E01E0040-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin 1 ELISA kit
E01E0040-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Total Endothelin ELISA kit
E01E0182-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Total Endothelin ELISA kit
E01E0182-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Total Endothelin ELISA kit
E01E0182-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Big Endothelin ELISA kit
E01B0662-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Big Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Big Endothelin ELISA kit
E01B0662-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Big Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Big Endothelin ELISA kit
E01B0662-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Big Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Endothelin
EK5427	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Endothelin in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Endothelin PicoKine ELISA Kit
EK0945	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Endothelin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Big Endothelin ELISA Kit
ELA-E0483h	Lifescience Market	96 Tests	EUR 824

Endothelin ELISA Kit (Human) (OKBB00471)
OKBB00471	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: The endothelins is a family of structurally and pharmacologically distinct peptides, which has been identified and sequenced in humans. Three isoforms of human endothelin have been identified: endothelin-1, -2, and -3. Endothelin-1 is a potent, 21-amino acid vasoconstrictor peptide produced by vascular endothelial cells. Endothelins are 21-amino acid vasoconstricting peptides produced primarily in the endothelium having a key role in vascular homeostasis. Endothelins are implicated in vascular diseases of several organ systems, including the heart, general circulation and brain. Endothelins are proteins that constrict blood vessels and raise blood pressure. They are normally kept in balance by other mechanisms, but when they are over-expressed, they contribute to high blood pressure (hypertension) and heart disease.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 0.5 pg/mL

EDN2 siRNA
20-abx901638	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EDN2 siRNA
20-abx914960	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EDN2 siRNA
20-abx914961	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EDN2 antibody
70R-9137	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal EDN2 antibody

EDN2 Antibody
35734-100ul	SAB	100ul	EUR 252

EDN2 antibody
70R-16997	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal EDN2 antibody

EDN2 Antibody
1-CSB-PA007401GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

EDN2 Antibody
1-CSB-PA161267	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

EDN2 Antibody
1-CSB-PA168757	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

EDN2 Antibody
1-CSB-PA033256	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

Anti-Endothelin Receptor ETA Antibody
A01828-2	BosterBio	100ug	EUR 397
Description: Rabbit Polyclonal Endothelin Receptor ETA Antibody. Validated in ELISA, WB and tested in Rat.

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Rat Endothelin 1,ET-2 ELISA Kit
CN-01966R2	ChemNorm	48T	EUR 316

EDN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0654003	ABM	1.0 ug DNA	EUR 154

Endothelin 2 Peptide
20-abx265190	Abbexa	EUR 565.00 EUR 829.00 EUR 1344.00	0.5 mg 1 mg 2.5 mg
Shipped within 5-10 working days.

anti-Endothelin 2
YF-PA11489	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Endothelin 2

anti-Endothelin 2
YF-PA11490	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Endothelin 2

Endothelin-1 ELISA Kit
K7429-100	Biovision		EUR 974

Rat Endothelin ELISA Kit
LF-EK50972	Abfrontier	1×96T	EUR 648

Mouse Endothelin ELISA Kit
LF-EK50973	Abfrontier	1×96T	EUR 648

Human EDN2 shRNA Plasmid
20-abx951326	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EDN2 Recombinant Protein (Human)
RP010177	ABM	100 ug	Ask for price

ELISA kit for Human ECE2 (Endothelin Converting Enzyme 2)
ELK5083	ELK Biotech	1 plate of 96 wells	EUR 432
A monoclonal antibody specific to Endothelin Converting Enzyme 2 (ECE2) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Endothelin Converting Enzyme 2 (ECE2) and unlabeled Endothelin Convert Show more
Description: A competitive Inhibition ELISA kit for detection of Endothelin Converting Enzyme 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Endothelin-converting enzyme 2 (ECE2)
KTE61958-48T	Abbkine	48T	EUR 332
Endothelin-converting enzymes, such as ECE2 are type II metalloproteases that generate functionally pleiotropic members of the endothelin vasoactive peptide family.The deduced protein contains 765 amino acids. ECE2 had an apparent molecular mass of 8 Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-converting enzyme 2 (ECE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Endothelin-converting enzyme 2 (ECE2)
KTE61958-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Endothelin-converting enzymes, such as ECE2 are type II metalloproteases that generate functionally pleiotropic members of the endothelin vasoactive peptide family.The deduced protein contains 765 amino acids. ECE2 had an apparent molecular mass of 8 Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-converting enzyme 2 (ECE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Endothelin-converting enzyme 2 (ECE2)
KTE61958-96T	Abbkine	96T	EUR 539
Endothelin-converting enzymes, such as ECE2 are type II metalloproteases that generate functionally pleiotropic members of the endothelin vasoactive peptide family.The deduced protein contains 765 amino acids. ECE2 had an apparent molecular mass of 8 Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-converting enzyme 2 (ECE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Endothelin 1 (EDN1) ELISA Kit
CEA482Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 1 (EDN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 1 (EDN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Endothelin 1 (EDN1) ELISA Kit
CEA482Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 1 (EDN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 1 (EDN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Endothelin 1 (EDN1) ELISA Kit
CEA482Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 1 (EDN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 1 (EDN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Endothelin 1 (EDN1) ELISA Kit
CEA482Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 1 (EDN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 1 (EDN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Endothelin 1 (EDN1) ELISA Kit
4-CEA482Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Endothelin 1 elisa. Alternative names of the recognized antigen: ET1 PPET1 Preproendothelin-1 Big endothelin-1
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Endothelin 1 (EDN1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Endothelin 1 (EDN1) ELISA Kit
abx575845-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Endothelin Receptor A ELISA kit
E01E0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin Receptor A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin Receptor A ELISA kit
E01E0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin Receptor A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin Receptor A ELISA kit
E01E0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin Receptor A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anti Endothelin 1 ELISA kit
E01E0177-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Anti Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anti Endothelin 1 ELISA kit
E01E0177-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Anti Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anti Endothelin 1 ELISA kit
E01E0177-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Anti Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin receptor B ELISA kit
E01E0180-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin receptor B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin receptor B ELISA kit
E01E0180-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin receptor B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin receptor B ELISA kit
E01E0180-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin receptor B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin 3(EDN3) ELISA kit
E01E0367-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin 3(EDN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin 3(EDN3) ELISA kit
E01E0367-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin 3(EDN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin 3(EDN3) ELISA kit
E01E0367-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin 3(EDN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Endothelin-3
EK4302	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Endothelin-3 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human EDN1/ Endothelin-1 ELISA Kit
E0757Hu	Sunlong	1 Kit	EUR 563

Human EDN3/ Endothelin-3 ELISA Kit
E0759Hu	Sunlong	1 Kit	EUR 571

Human EDN1(Endothelin-1) ELISA Kit
EH0648	FN Test	96T	EUR 476.25
Detection range: 1.25-80 pg/ml Uniprot ID: P05305 Alias: ET-1/EDN1/ET1/HDLCQ7/PPET1/Preproendothelin-1/endothelin 1/endothelin-1/preproendothelin-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.75pg/ml

Human EDN3(Endothelin-3) ELISA Kit
EH2113	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: P14138 Alias: EDN3/endothelin 3/endothelin-3/ET3/ET-3/HSCR4/PPET3/preproendothelin-3/Preproendothelin-3/truncated endothelin 3/WS4B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human Endothelin- 3, EDN3 ELISA KIT
ELI-06804h	Lifescience Market	96 Tests	EUR 824

Human Endothelin 1 (EDN1) ELISA Kit
20-abx151410	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Endothelin 1 (EDN1) ELISA Kit
abx257759-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Endothelin 3 (EDN3) ELISA Kit
abx251446-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Endothelin 1 (EDN1) ELISA Kit
abx253612-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Endothelin 1 (EDN1) ELISA Kit
DLR-EDN1-Hu-48T	DL Develop	48T	EUR 425
Should the Human Endothelin 1 (EDN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Endothelin 1 (EDN1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Endothelin 1 (EDN1) ELISA Kit
DLR-EDN1-Hu-96T	DL Develop	96T	EUR 548
Should the Human Endothelin 1 (EDN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Endothelin 1 (EDN1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Endothelin-3(EDN3) ELISA kit
CSB-EL007402HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-3 (EDN3) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Endothelin-3(EDN3) ELISA kit
1-CSB-EL007402HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-3(EDN3) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Endothelin 1 ELISA Kit (EDN1)
RK01295	Abclonal	96 Tests	EUR 521

Human Endothelin 1 (EDN1) ELISA Kit
RDR-EDN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 436

Human Endothelin 1 (EDN1) ELISA Kit
RDR-EDN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 601

Human Endothelin 1 (EDN1) ELISA Kit
RD-EDN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 418

Human Endothelin 1 (EDN1) ELISA Kit
RD-EDN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 575

Bovine Endothelin- converting enzyme 2, ECE2 ELISA KIT
ELI-26029b	Lifescience Market	96 Tests	EUR 928

Mouse Endothelin- converting enzyme 2, Ece2 ELISA KIT
ELI-48135m	Lifescience Market	96 Tests	EUR 865

EDN2 Conjugated Antibody
C35734	SAB	100ul	EUR 397

EDN2 cloning plasmid
CSB-CL007401HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 537 Sequence: atggtctccgtgcctaccacctggtgctccgttgcgctagccctgctcgtggccctgcatgaagggaagggccaggctgctgccaccctggagcagccagcgtcctcatctcatgcccaaggcacccaccttcggcttcgccgttgctcctgcagctcctggctcgacaaggagtg Show more
Description: A cloning plasmid for the EDN2 gene.

EDN2 Polyclonal Antibody
ES11086-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against EDN2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

EDN2 Polyclonal Antibody
ES11086-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against EDN2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

EDN2 Polyclonal Antibody
ABP58455-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human EDN2 protein Applications tips:
Description: A polyclonal antibody for detection of EDN2 from Human, Mouse, Rat. This EDN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDN2 protein

EDN2 Polyclonal Antibody
ABP58455-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human EDN2 protein Applications tips:
Description: A polyclonal antibody for detection of EDN2 from Human, Mouse, Rat. This EDN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDN2 protein

EDN2 Polyclonal Antibody
ABP58455-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human EDN2 protein Applications tips:
Description: A polyclonal antibody for detection of EDN2 from Human, Mouse, Rat. This EDN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDN2 protein

EDN2 Blocking Peptide
33R-6611	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EDN2 antibody, catalog no. 70R-9137

Anti-EDN2 antibody
STJ192244	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to EDN2

Human Endothelin B receptor- like protein 2, GPR37L1 ELISA KIT
ELI-47497h	Lifescience Market	96 Tests	EUR 824

Endothelin-2, His Protein
20-abx260784	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Goat Endothelin 1 ELISA kit
E06E0040-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Endothelin 1 ELISA kit
E06E0040-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Endothelin 1 ELISA kit
E06E0040-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Total Endothelin ELISA kit
E06E0182-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Total Endothelin ELISA kit
E06E0182-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Total Endothelin ELISA kit
E06E0182-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Big Endothelin ELISA kit
E06B0662-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Big Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Big Endothelin ELISA kit
E06B0662-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Big Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Big Endothelin ELISA kit
E06B0662-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Big Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Endothelin 1 ELISA kit
E02E0040-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Endothelin 1 ELISA kit
E02E0040-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Endothelin 1 ELISA kit
E02E0040-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Total Endothelin ELISA kit
E02E0182-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Total Endothelin ELISA kit
E02E0182-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Total Endothelin ELISA kit
E02E0182-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Endothelin 1 ELISA kit
E03E0040-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Endothelin 1 ELISA kit
E03E0040-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human EDN2(Endothelin 2) ELISA Kit