Human EDN2(Endothelin 2) ELISA Kit

Human EDN2(Endothelin 2) ELISA Kit

Human Endothelin 2 (EDN2) ELISA Kit

RDR-EDN2-Hu-96Tests 96 Tests
EUR 665

Human Endothelin 2 (EDN2) ELISA Kit

RD-EDN2-Hu-48Tests 48 Tests
EUR 460

Human Endothelin 2 (EDN2) ELISA Kit

RD-EDN2-Hu-96Tests 96 Tests
EUR 636

Rat Endothelin 2 (EDN2) ELISA Kit

DLR-EDN2-Ra-48T 48T
EUR 495
  • Should the Rat Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Endothelin 2 (EDN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit

DLR-EDN2-Ra-96T 96T
EUR 644
  • Should the Rat Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Endothelin 2 (EDN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit

RDR-EDN2-Ra-48Tests 48 Tests
EUR 519

Rat Endothelin 2 (EDN2) ELISA Kit

RDR-EDN2-Ra-96Tests 96 Tests
EUR 720

Rat Endothelin 2 (EDN2) ELISA Kit

RD-EDN2-Ra-48Tests 48 Tests
EUR 496

Rat Endothelin 2 (EDN2) ELISA Kit

RD-EDN2-Ra-96Tests 96 Tests
EUR 688

Human Endothelin 2 (EDN2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human EDN2/ Endothelin-2 ELISA Kit

E0758Hu 1 Kit
EUR 571

Human EDN2(Endothelin-2) ELISA Kit

EH2114 96T
EUR 567.6
  • Detection range: 0.781-50 pg/ml
  • Uniprot ID: P20800
  • Alias: ET-2/Preproendothelin-2(PPET2)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469pg/ml

Human Endothelin- 2, EDN2 ELISA KIT

ELI-06811h 96 Tests
EUR 824

Human Endothelin 2 (EDN2) ELISA Kit

CEF415Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit

CEF415Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit

CEF415Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit

CEF415Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids.

Human Endothelin 2 (EDN2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Endothelin 2 elisa. Alternative names of the recognized antigen: ET2
  • PPET2
  • Preproendothelin-2
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Endothelin 2 (EDN2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Endothelin-2(EDN2)ELISA Kit

CSB-E16518h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-2 (EDN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Endothelin-2(EDN2)ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-2(EDN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Endothelin 2 (EDN2) ELISA Kit

abx576570-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Endothelin 2 (EDN2) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Endothelin 2 (EDN2) ELISA Kit

abx255075-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Edn2/ Endothelin-2 ELISA Kit

E1635Mo 1 Kit
EUR 571

Bovine Endothelin- 2, EDN2 ELISA KIT

ELI-06807b 96 Tests
EUR 928

Rabbit Endothelin- 2, EDN2 ELISA KIT

ELI-06808Ra 96 Tests
EUR 928

Mouse Endothelin- 2, Edn2 ELISA KIT

ELI-06809m 96 Tests
EUR 865

Rat Endothelin 2 (EDN2) ELISA Kit

CEF415Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit

CEF415Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit

CEF415Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit

CEF415Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Endothelin 2 (EDN2) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Endothelin 2 elisa. Alternative names of the recognized antigen: ET2
  • PPET2
  • Preproendothelin-2
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Endothelin 2 (EDN2) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Endothelin-2(EDN2) ELISA kit

CSB-EL007401MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Endothelin-2 (EDN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Endothelin-2(EDN2) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Endothelin-2(EDN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Endothelin 2 (EDN2) ELISA Kit

abx575853-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Cow Endothelin 2 (EDN2) ELISA Kit

abx519466-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Endothelin 2 (EDN2) ELISA Kit

abx519467-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Edn2(Endothelin-2) ELISA Kit

EM0727 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P22389
  • Alias: Edn2/ET-2/Preproendothelin-2(PPET2)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml

ELISA kit for Human EDN2 (Endothelin 2)

ELK5069 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Endothelin 2 (EDN2) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Endothelin 2 (EDN2) and unlabeled Endothelin 2 (EDN2) (Standards or samples) with the pr
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Endothelin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Endothelin-2 (EDN2)

KTE61953-48T 48T
EUR 332
  • Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Endothelin-2 (EDN2)

KTE61953-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Endothelin-2 (EDN2)

KTE61953-96T 96T
EUR 539
  • Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Endothelin 2 (EDN2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Endothelin 2 (EDN2) Antibody

abx027651-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody

abx027651-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody

  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Endothelin 2 (EDN2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Endothelin 2 (EDN2) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Endothelin 2 (EDN2) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Endothelin 2 (EDN2) Protein

  • EUR 328.00
  • EUR 2736.00
  • EUR 787.00
  • 1 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Endothelin 2 (EDN2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Endothelin 2 (EDN2)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20800
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Endothelin 2 expressed in: E.coli

Human Endothelin 2 (EDN2) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

EDN2 Human Endothelin-2 protein

PROTP20800-1 Regular: 5mg
EUR 697
Description: EDN2 contains 21 amino acids having a molecular mass of 2546.97 Dalton.

ELISA kit for Rat EDN2 (Endothelin 2)

ELK6274 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Endothelin 2 (EDN2) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Endothelin 2 (EDN2) and unlabeled Endothelin 2 (EDN2) (Standards or samples) with the pr
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Endothelin 2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Edn2 ELISA Kit| Mouse Endothelin-2 ELISA Kit

EF013338 96 Tests
EUR 689

Rat Endothelin 2 (EDN2) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Endothelin 2 (EDN2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Endothelin 2 (EDN2) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2)

Endothelin 2 (EDN2) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with APC.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with Biotin.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with Cy3.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with FITC.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with HRP.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with PE.

Endothelin 2 (EDN2) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDN2 (Gln32~Arg178)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with APC-Cy7.

EDN2 Human, Endothelin-2 Human Recombinant Protein, His Tag

PROTP20800 Regular: 20ug
EUR 317
Description: EDN2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 177 amino acids (25-178 a.a.) and having a molecular mass of 19.9kDa. EDN2 is fused to a 23 amino acid His-tag at N-terminus.

ET-2/EDN2/ Rat ET- 2/ EDN2 ELISA Kit

ELA-E14916r 96 Tests
EUR 886

Edn2/ Rat Edn2 ELISA Kit

ELI-06810r 96 Tests
EUR 886

Human EDN2 ELISA Kit

ELA-E2118h 96 Tests
EUR 824


EF006192 96 Tests
EUR 689

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

ELISA kit for Human Endothelin-2

EK4305 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Endothelin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.


ELI-06806d 96 Tests
EUR 928

Human Endothelin-2

7-02164 1mg Ask for price

Human Endothelin-2

7-02165 5mg Ask for price

Human Endothelin-2

7-02166 25mg Ask for price

Endothelin-2, human

HY-P0207 500ug
EUR 349

Human Endothelin ELISA Kit

LF-EK50969 1×96T
EUR 648

EDN2 ELISA Kit (Rat) (OKCD02399)

OKCD02399 96 Wells
EUR 896
Description: Description of target: Vasoconstrictor. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive Inhibition ELISA;Sensitivity: < 2.67 pg/mL

EDN2 ELISA Kit (Rat) (OKEH06451)

OKEH06451 96 Wells
EUR 662
Description: Description of target: Vasoconstrictor. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 42.3 pg/mL

EDN2 ELISA Kit (Mouse) (OKEH01507)

OKEH01507 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the endothelin family of peptides. The encoded preproprotein undergoes proteolytic processing to generate a potent vasoconstrictive peptide. This gene is abundantly expressed in the gastrointestinal tract, strongly induced in photorecepteror cells in retinal diseases and injury, and produced by microglia and macrophages in the early stages of glaucoma. Mice lacking the encoded protein exhibit severe growth retardation, hypothermia and juvenile lethality.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.044 ng/mL

ELISA kit for Mouse Endothelin-2

EK4304 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Endothelin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

EDN2 ELISA Kit (Human) : 96 Wells (OKEH00573)

OKEH00573 96 Wells
EUR 662
Description: Description of target: Endothelins are endothelium-derived vasoconstrictor peptides.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL

Human Endothelin-2 Antibody

32148-05111 150 ug
EUR 261

Human Endothelin-2 Antibody

10811-05011 150 ug
EUR 217

Endothelin 2 (human, canine)

5-01099 0.4 x 5mg Ask for price

Big Endothelin-2 (human)

H-7566.0100 0.1mg
EUR 271
Description: Sum Formula: C194H281N49O57S4; CAS# [151853-67-7] net

Endothelin-2 (human, canine)

H-7768.0500 0.5mg
EUR 248
Description: Sum Formula: C115H160N26O32S4; CAS# [123562-20-9] net

Endothelin-2 (human, canine)

H-7768.1000 1.0mg
EUR 383
Description: Sum Formula: C115H160N26O32S4; CAS# [123562-20-9] net

Endothelin-2 (human, canine)

H-9020.0500 0.5mg
EUR 576
Description: Sum Formula: C115H160N26O32S4; CAS# [123562-20-9] net

Endothelin-2 (human, canine)

H-9020.1000 1.0mg
EUR 998
Description: Sum Formula: C115H160N26O32S4; CAS# [123562-20-9] net

Human Endothelin Converting Enzyme 2 (ECE2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Endothelin Converting Enzyme 2 (ECE2) ELISA Kit

CEF414Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin Converting Enzyme 2 (ECE2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin Converting Enzyme 2 (ECE2) in Tissue homogenates, cell lysates and other biological fluids.

Human Endothelin Converting Enzyme 2 (ECE2) ELISA Kit

CEF414Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin Converting Enzyme 2 (ECE2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin Converting Enzyme 2 (ECE2) in Tissue homogenates, cell lysates and other biological fluids.

Human Endothelin Converting Enzyme 2 (ECE2) ELISA Kit

CEF414Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin Converting Enzyme 2 (ECE2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin Converting Enzyme 2 (ECE2) in Tissue homogenates, cell lysates and other biological fluids.

Human Endothelin Converting Enzyme 2 (ECE2) ELISA Kit

CEF414Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin Converting Enzyme 2 (ECE2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin Converting Enzyme 2 (ECE2) in Tissue homogenates, cell lysates and other biological fluids.

Human Endothelin Converting Enzyme 2 (ECE2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Endothelin Converting Enzyme 2 elisa. Alternative names of the recognized antigen: Methyltransferase-like region
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Endothelin Converting Enzyme 2 (ECE2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Endothelin- converting enzyme 2, ECE2 ELISA KIT

ELI-47594h 96 Tests
EUR 824

Human Big Endothelin ELISA kit

E01B0662-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Big Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Big Endothelin ELISA kit

E01B0662-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Big Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Big Endothelin ELISA kit

E01B0662-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Big Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin 1 ELISA kit

E01E0040-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin 1 ELISA kit

E01E0040-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin 1 ELISA kit

E01E0040-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Total Endothelin ELISA kit

E01E0182-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Total Endothelin ELISA kit

E01E0182-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Total Endothelin ELISA kit

E01E0182-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Endothelin

EK5427 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Endothelin in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Endothelin PicoKine ELISA Kit

EK0945 96 wells
EUR 425
Description: For quantitative detection of human Endothelin in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Big Endothelin ELISA Kit

ELA-E0483h 96 Tests
EUR 824

Endothelin ELISA Kit (Human) (OKBB00471)

OKBB00471 96 Wells
EUR 505
Description: Description of target: The endothelins is a family of structurally and pharmacologically distinct peptides, which has been identified and sequenced in humans. Three isoforms of human endothelin have been identified: endothelin-1, -2, and -3. Endothelin-1 is a potent, 21-amino acid vasoconstrictor peptide produced by vascular endothelial cells. Endothelins are 21-amino acid vasoconstricting peptides produced primarily in the endothelium having a key role in vascular homeostasis. Endothelins are implicated in vascular diseases of several organ systems, including the heart, general circulation and brain. Endothelins are proteins that constrict blood vessels and raise blood pressure. They are normally kept in balance by other mechanisms, but when they are over-expressed, they contribute to high blood pressure (hypertension) and heart disease.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 0.5 pg/mL

EDN2 antibody

70R-16997 50 ul
EUR 435
Description: Rabbit polyclonal EDN2 antibody

EDN2 Antibody

35734-100ul 100ul
EUR 252

EDN2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

EDN2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

EDN2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

EDN2 antibody

70R-9137 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal EDN2 antibody

EDN2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-Endothelin Receptor ETA Antibody

A01828-2 100ug
EUR 397
Description: Rabbit Polyclonal Endothelin Receptor ETA Antibody. Validated in ELISA, WB and tested in Rat.


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Rat Endothelin 1,ET-2 ELISA Kit

CN-01966R2 48T
EUR 316

EDN2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0654003 1.0 ug DNA
EUR 154

Endothelin 2 Peptide

  • EUR 565.00
  • EUR 829.00
  • EUR 1344.00
  • 0.5 mg
  • 1 mg
  • 2.5 mg
  • Shipped within 5-10 working days.

anti-Endothelin 2

YF-PA11489 50 ul
EUR 363
Description: Mouse polyclonal to Endothelin 2

anti-Endothelin 2

YF-PA11490 50 ug
EUR 363
Description: Mouse polyclonal to Endothelin 2

Endothelin-1 ELISA Kit

EUR 974

Rat Endothelin ELISA Kit

LF-EK50972 1×96T
EUR 648

Mouse Endothelin ELISA Kit

LF-EK50973 1×96T
EUR 648

Human EDN2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EDN2 Recombinant Protein (Human)

RP010177 100 ug Ask for price

ELISA kit for Human ECE2 (Endothelin Converting Enzyme 2)

ELK5083 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Endothelin Converting Enzyme 2 (ECE2) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Endothelin Converting Enzyme 2 (ECE2) and unlabeled Endothelin Convert
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Endothelin Converting Enzyme 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Endothelin-converting enzyme 2 (ECE2)

KTE61958-48T 48T
EUR 332
  • Endothelin-converting enzymes, such as ECE2 are type II metalloproteases that generate functionally pleiotropic members of the endothelin vasoactive peptide family.The deduced protein contains 765 amino acids. ECE2 had an apparent molecular mass of 8
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-converting enzyme 2 (ECE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Endothelin-converting enzyme 2 (ECE2)

KTE61958-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Endothelin-converting enzymes, such as ECE2 are type II metalloproteases that generate functionally pleiotropic members of the endothelin vasoactive peptide family.The deduced protein contains 765 amino acids. ECE2 had an apparent molecular mass of 8
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-converting enzyme 2 (ECE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Endothelin-converting enzyme 2 (ECE2)

KTE61958-96T 96T
EUR 539
  • Endothelin-converting enzymes, such as ECE2 are type II metalloproteases that generate functionally pleiotropic members of the endothelin vasoactive peptide family.The deduced protein contains 765 amino acids. ECE2 had an apparent molecular mass of 8
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Endothelin-converting enzyme 2 (ECE2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Endothelin 1 (EDN1) ELISA Kit

DLR-EDN1-Hu-48T 48T
EUR 425
  • Should the Human Endothelin 1 (EDN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Endothelin 1 (EDN1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Endothelin 1 (EDN1) ELISA Kit

DLR-EDN1-Hu-96T 96T
EUR 548
  • Should the Human Endothelin 1 (EDN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Endothelin 1 (EDN1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Endothelin Receptor A ELISA kit

E01E0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin Receptor A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin Receptor A ELISA kit

E01E0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin Receptor A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin Receptor A ELISA kit

E01E0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin Receptor A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anti Endothelin 1 ELISA kit

E01E0177-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Anti Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anti Endothelin 1 ELISA kit

E01E0177-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Anti Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anti Endothelin 1 ELISA kit

E01E0177-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Anti Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin receptor B ELISA kit

E01E0180-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin receptor B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin receptor B ELISA kit

E01E0180-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin receptor B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin receptor B ELISA kit

E01E0180-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin receptor B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin 3(EDN3) ELISA kit

E01E0367-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin 3(EDN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin 3(EDN3) ELISA kit

E01E0367-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin 3(EDN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin 3(EDN3) ELISA kit

E01E0367-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Endothelin 3(EDN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Endothelin 1 (EDN1) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Endothelin 1 (EDN1) ELISA Kit

abx257759-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Endothelin 3 (EDN3) ELISA Kit

abx251446-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Endothelin 1 (EDN1) ELISA Kit

abx253612-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Endothelin-3

EK4302 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Endothelin-3 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human EDN1/ Endothelin-1 ELISA Kit

E0757Hu 1 Kit
EUR 563

Human EDN3/ Endothelin-3 ELISA Kit

E0759Hu 1 Kit
EUR 571

Human EDN1(Endothelin-1) ELISA Kit

EH0648 96T
EUR 476.25
  • Detection range: 1.25-80 pg/ml
  • Uniprot ID: P05305
  • Alias: ET-1/EDN1/ET1/HDLCQ7/PPET1/Preproendothelin-1/endothelin 1/endothelin-1/preproendothelin-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.75pg/ml

Human EDN3(Endothelin-3) ELISA Kit

EH2113 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P14138
  • Alias: EDN3/endothelin 3/endothelin-3/ET3/ET-3/HSCR4/PPET3/preproendothelin-3/Preproendothelin-3/truncated endothelin 3/WS4B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human Endothelin- 3, EDN3 ELISA KIT

ELI-06804h 96 Tests
EUR 824

Human Endothelin 1 (EDN1) ELISA Kit

CEA482Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 1 (EDN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 1 (EDN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Endothelin 1 (EDN1) ELISA Kit

CEA482Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 1 (EDN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 1 (EDN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Endothelin 1 (EDN1) ELISA Kit

CEA482Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 1 (EDN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 1 (EDN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Endothelin 1 (EDN1) ELISA Kit

CEA482Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 1 (EDN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 1 (EDN1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Endothelin 1 (EDN1) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Endothelin 1 elisa. Alternative names of the recognized antigen: ET1
  • PPET1
  • Preproendothelin-1
  • Big endothelin-1
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Endothelin 1 (EDN1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Endothelin-3(EDN3) ELISA kit

CSB-EL007402HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-3 (EDN3) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Endothelin-3(EDN3) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-3(EDN3) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Endothelin 1 (EDN1) ELISA Kit

abx575845-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Endothelin 1 ELISA Kit (EDN1)

RK01295 96 Tests
EUR 521

Human Endothelin 1 (EDN1) ELISA Kit

RDR-EDN1-Hu-48Tests 48 Tests
EUR 436

Human Endothelin 1 (EDN1) ELISA Kit

RDR-EDN1-Hu-96Tests 96 Tests
EUR 601

Human Endothelin 1 (EDN1) ELISA Kit

RD-EDN1-Hu-48Tests 48 Tests
EUR 418

Human Endothelin 1 (EDN1) ELISA Kit

RD-EDN1-Hu-96Tests 96 Tests
EUR 575

Bovine Endothelin- converting enzyme 2, ECE2 ELISA KIT

ELI-26029b 96 Tests
EUR 928

Mouse Endothelin- converting enzyme 2, Ece2 ELISA KIT

ELI-48135m 96 Tests
EUR 865

EDN2 Blocking Peptide

33R-6611 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EDN2 antibody, catalog no. 70R-9137

EDN2 Polyclonal Antibody

ABP58455-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human EDN2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDN2 from Human, Mouse, Rat. This EDN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDN2 protein

EDN2 Polyclonal Antibody

ABP58455-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EDN2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDN2 from Human, Mouse, Rat. This EDN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDN2 protein

EDN2 Polyclonal Antibody

ABP58455-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EDN2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDN2 from Human, Mouse, Rat. This EDN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDN2 protein

EDN2 Conjugated Antibody

C35734 100ul
EUR 397

EDN2 cloning plasmid

CSB-CL007401HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 537
  • Sequence: atggtctccgtgcctaccacctggtgctccgttgcgctagccctgctcgtggccctgcatgaagggaagggccaggctgctgccaccctggagcagccagcgtcctcatctcatgcccaaggcacccaccttcggcttcgccgttgctcctgcagctcctggctcgacaaggagtg
  • Show more
Description: A cloning plasmid for the EDN2 gene.

EDN2 Polyclonal Antibody

ES11086-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EDN2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

EDN2 Polyclonal Antibody

ES11086-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EDN2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-EDN2 antibody

STJ192244 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EDN2

Human Endothelin B receptor- like protein 2, GPR37L1 ELISA KIT

ELI-47497h 96 Tests
EUR 824

Endothelin-2, His Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Rat Total Endothelin ELISA kit

E02E0182-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Total Endothelin ELISA kit

E02E0182-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Total Endothelin ELISA kit

E02E0182-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Endothelin 1 ELISA kit

E02E0040-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Endothelin 1 ELISA kit

E02E0040-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Endothelin 1 ELISA kit

E02E0040-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Endothelin 1 ELISA kit

E03E0040-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Endothelin 1 ELISA kit

E03E0040-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Endothelin 1 ELISA kit

E03E0040-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Total Endothelin ELISA kit

E03E0182-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Total Endothelin ELISA kit

E03E0182-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Total Endothelin ELISA kit

E03E0182-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Total Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Big Endothelin ELISA kit

E03B0662-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Big Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Big Endothelin ELISA kit

E03B0662-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Big Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Big Endothelin ELISA kit

E03B0662-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Big Endothelin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Endothelin 1 ELISA kit

E06E0040-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Endothelin 1 ELISA kit

E06E0040-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Endothelin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human EDN2(Endothelin 2) ELISA Kit