Human SESN2(Sestrin 2) ELISA Kit

Human SESN2(Sestrin 2) ELISA Kit

Human Sestrin 2 (SESN2) ELISA Kit

RD-SESN2-Hu-48Tests 48 Tests
EUR 521

Human Sestrin 2 (SESN2) ELISA Kit

RD-SESN2-Hu-96Tests 96 Tests
EUR 723

Human Sestrin 2 (SESN2) ELISA Kit

RDR-SESN2-Hu-48Tests 48 Tests
EUR 544

Human Sestrin 2 (SESN2) ELISA Kit

RDR-SESN2-Hu-96Tests 96 Tests
EUR 756

Mouse Sestrin 2 (SESN2) ELISA Kit

DLR-SESN2-Mu-48T 48T
EUR 527
  • Should the Mouse Sestrin 2 (SESN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 2 (SESN2) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit

DLR-SESN2-Mu-96T 96T
EUR 688
  • Should the Mouse Sestrin 2 (SESN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 2 (SESN2) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit

RD-SESN2-Mu-48Tests 48 Tests
EUR 533

Mouse Sestrin 2 (SESN2) ELISA Kit

RD-SESN2-Mu-96Tests 96 Tests
EUR 740

Mouse Sestrin 2 (SESN2) ELISA Kit

RDR-SESN2-Mu-48Tests 48 Tests
EUR 557

Mouse Sestrin 2 (SESN2) ELISA Kit

RDR-SESN2-Mu-96Tests 96 Tests
EUR 774

Human Sestrin 2 (SESN2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Sestrin 2 (SESN2) ELISA Kit

abx250844-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Sestrin 2, SESN2 ELISA Kit

ELA-E14936h 96 Tests
EUR 824

Human SESN2/ Sestrin-2 ELISA Kit

E2268Hu 1 Kit
EUR 571

Human SESN2(Sestrin-2) ELISA Kit

EH1556 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P58004
  • Alias: SESN2/Sestrin-2/Hi95/SEST2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Sestrin- 2, SESN2 ELISA KIT

ELI-04562h 96 Tests
EUR 824

Human Sestrin 2(SESN2)ELISA Kit

QY-E04602 96T
EUR 361

Human Sestrin 2 ELISA Kit (SESN2)

RK02270 96 Tests
EUR 521

Human Sestrin 2 (SESN2) ELISA Kit

SEC840Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 2 (SESN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 2 (SESN2) ELISA Kit

SEC840Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 2 (SESN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 2 (SESN2) ELISA Kit

SEC840Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 2 (SESN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 2 (SESN2) ELISA Kit

SEC840Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 2 (SESN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 2 (SESN2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sestrin 2 elisa. Alternative names of the recognized antigen: HI95
  • SES2
  • SEST2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sestrin 2 (SESN2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Sestrin 2 (SESN2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Sestrin 2 (SESN2) ELISA Kit

abx254413-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Bovine Sestrin- 2, SESN2 ELISA KIT

ELI-04561b 96 Tests
EUR 928

Mouse Sestrin- 2, Sesn2 ELISA KIT

ELI-04563m 96 Tests
EUR 865

Mouse Sestrin 2 (SESN2) ELISA Kit

abx570705-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Cow Sestrin 2 (SESN2) ELISA Kit

abx516719-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse SESN2(Sestrin 2) ELISA Kit

EM1356 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P58043
  • Alias: SESN2/Sestrin-2/Hi95/SEST2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Mouse Sestrin 2 (SESN2) ELISA Kit

SEC840Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 2 (SESN2) in Tissue homogenates and other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit

SEC840Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 2 (SESN2) in Tissue homogenates and other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit

SEC840Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 2 (SESN2) in Tissue homogenates and other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit

SEC840Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 2 (SESN2) in Tissue homogenates and other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sestrin 2 elisa. Alternative names of the recognized antigen: HI95
  • SES2
  • SEST2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Sestrin 2 (SESN2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Sestrin 2 (SESN2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sestrin 2 (SESN2) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sestrin 2 (SESN2) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sestrin 2 (SESN2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sestrin 2 (SESN2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sestrin 2 (SESN2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sestrin 2 (SESN2) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sestrin 2 (SESN2) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sestrin 2 (SESN2) Antibody

abx237762-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sestrin 2 (SESN2) Antibody

abx237763-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Sestrin 2 (SESN2)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P58043
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Sestrin 2 expressed in: E.coli

ELISA kit for Human SESN2 (Sestrin 2)

ELK4979 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 2 (SESN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 2 (SESN2
  • Show more
Description: A sandwich ELISA kit for detection of Sestrin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Sestrin-2 (SESN2)

KTE60686-48T 48T
EUR 332
  • Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-2 (SESN2)

KTE60686-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-2 (SESN2)

KTE60686-96T 96T
EUR 539
  • Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Sestrin 2 (SESN2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Sestrin 2 (SESN2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Mouse SESN2 (Sestrin 2)

E-EL-M1048 1 plate of 96 wells
EUR 534
  • Gentaur's SESN2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse SESN2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse SESN2 (Sestrin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse SESN2 (Sestrin 2)

ELK6072 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 2 (SESN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 2 (SESN2
  • Show more
Description: A sandwich ELISA kit for detection of Sestrin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Sestrin-2 (SESN2)

KTE70446-48T 48T
EUR 332
  • Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-2 (SESN2)

KTE70446-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-2 (SESN2)

KTE70446-96T 96T
EUR 539
  • Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SESN2 ELISA Kit| Mouse Sestrin 2 ELISA Kit

EF013887 96 Tests
EUR 689

Mouse Sestrin 2 (SESN2) CLIA Kit

abx197680-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Sestrin 2 (SESN2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Sestrin 2 (SESN2) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CLIA kit for Mouse SESN2 (Sestrin 2)

E-CL-M0609 1 plate of 96 wells
EUR 584
  • Gentaur's SESN2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse SESN2 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse SESN2 (Sestrin 2) in samples from Serum, Plasma, Cell supernatant

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2)

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with APC.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with Biotin.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with Cy3.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with FITC.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with HRP.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with PE.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with APC-Cy7.

ELISA kit for Human Sestrin-2

EK3326 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sestrin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.


ELA-E1401h 96 Tests
EUR 824


EF007332 96 Tests
EUR 689

SESN2 ELISA Kit (Human) (OKAN05560)

OKAN05560 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

SESN2 ELISA Kit (Human) (OKCD08268)

OKCD08268 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL

SESN2 ELISA Kit (Human) (OKEH00986)

OKEH00986 96 Wells
EUR 740
Description: Description of target: This gene encodes a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

Recombinant human Sestrin-2

P1238 100ug Ask for price
  • Uniprot ID: P58004
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Sestrin-2

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human Sestrin 1 ELISA Kit

ELA-E12182h 96 Tests
EUR 824

Sestrin 2 Antibody

DF12003 200ul
EUR 304
Description: Sestrin 2 antibody detects endogenous levels of Sestrin 2.

SESN2 ELISA Kit (Mouse) (OKCD02885)

OKCD02885 96 Wells
EUR 857
Description: Description of target: Functions as an intracellular leucine sensor that negatively regulates the TORC1 signaling pathway through the GATOR complex. In absence of leucine, binds the GATOR subcomplex GATOR2 and prevents TORC1 signaling. Binding of leucine to SESN2 disrupts its interaction with GATOR2 thereby activating the TORC1 signaling pathway. This stress-inducible metabolic regulator also plays a role in protection against oxidative and genotoxic stresses. May negatively regulate protein translation in response to endoplasmic reticulum stress, via TORC1. May positively regulate the transcription by NFE2L2 of genes involved in the response to oxidative stress by facilitating the SQSTM1-mediated autophagic degradation of KEAP1. May also mediate TP53 inhibition of TORC1 signaling upon genotoxic stress. Has an alkylhydroperoxide reductase activity born by the N-terminal domain of the protein. Was originally reported to contribute to oxidative stress resistance by reducing PRDX1. However, this could not be confirmed.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.049 ng/mL

Human Sestrin 1 (SESN1)ELISA kit

201-12-2523 96 tests
EUR 440
  • This Sestrin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit

DLR-SESN1-Hu-48T 48T
EUR 517
  • Should the Human Sestrin 1 (SESN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sestrin 1 (SESN1) in samples from tissue homogenates or other biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit

DLR-SESN1-Hu-96T 96T
EUR 673
  • Should the Human Sestrin 1 (SESN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sestrin 1 (SESN1) in samples from tissue homogenates or other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit

DLR-SESN3-Hu-48T 48T
EUR 517
  • Should the Human Sestrin 3 (SESN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sestrin 3 (SESN3) in samples from tissue homogenates or other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit

DLR-SESN3-Hu-96T 96T
EUR 673
  • Should the Human Sestrin 3 (SESN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sestrin 3 (SESN3) in samples from tissue homogenates or other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Sestrin 3 (SESN3) ELISA Kit

abx253786-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Sestrin 1 (SESN1) ELISA Kit

abx253865-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Sestrin 1 (SESN1) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

ELISA kit for Human Sestrin-1

EK1762 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sestrin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Sestrin-3

EK1606 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sestrin-3 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Sestrin 3, SESN3 ELISA kit

ELA-E12181h 96 Tests
EUR 824

Human SESN1/ Sestrin-1 ELISA Kit

E2267Hu 1 Kit
EUR 571

Human SESN3/ Sestrin-3 ELISA Kit

E2269Hu 1 Kit
EUR 571

Human SESN3(Sestrin-3) ELISA Kit

EH0829 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P58005
  • Alias: SESN3(Sestrin-3)/SEST3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human SESN1(Sestrin-1) ELISA Kit

EH0909 96T
EUR 567.6
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q9Y6P5
  • Alias: SESN1(Sestrin-1)/PA26/SEST1/p53-regulated protein PA26/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Sestrin 3(SESN3)ELISA Kit  

QY-E04601 96T
EUR 394

Human Sestrin 1(SESN1)ELISA Kit

QY-E04603 96T
EUR 361

Human Sestrin 1 ELISA Kit (SESN1)

RK02269 96 Tests
EUR 521

Human Sestrin 3 ELISA Kit (SESN3)

RK02271 96 Tests
EUR 521

Human Sestrin 1 (SESN1) ELISA Kit

RD-SESN1-Hu-48Tests 48 Tests
EUR 521

Human Sestrin 1 (SESN1) ELISA Kit

RD-SESN1-Hu-96Tests 96 Tests
EUR 723

Human Sestrin 3 (SESN3) ELISA Kit

RD-SESN3-Hu-48Tests 48 Tests
EUR 521

Human Sestrin 3 (SESN3) ELISA Kit

RD-SESN3-Hu-96Tests 96 Tests
EUR 723

Human Sestrin 1 (SESN1) ELISA Kit

RDR-SESN1-Hu-48Tests 48 Tests
EUR 544

Human Sestrin 1 (SESN1) ELISA Kit

RDR-SESN1-Hu-96Tests 96 Tests
EUR 756

Human Sestrin 3 (SESN3) ELISA Kit

RDR-SESN3-Hu-48Tests 48 Tests
EUR 544

Human Sestrin 3 (SESN3) ELISA Kit

RDR-SESN3-Hu-96Tests 96 Tests
EUR 756

Human Sestrin 3 (SESN3) ELISA Kit

SEF876Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 3 (SESN3) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit

SEF876Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 3 (SESN3) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit

SEF876Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 3 (SESN3) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit

SEF876Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 3 (SESN3) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sestrin 3 elisa. Alternative names of the recognized antigen: SEST3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sestrin 3 (SESN3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Sestrin 1 (SESN1) ELISA Kit

SEF877Hu-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit

SEF877Hu-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit

SEF877Hu-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit

SEF877Hu-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sestrin 1 elisa. Alternative names of the recognized antigen: SEST1
  • PA26
  • p53-regulated protein PA26
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sestrin 1 (SESN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Sestrin 2 Blocking Peptide

DF12003-BP 1mg
EUR 195

anti- Sestrin 2 antibody

FNab07762 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:100-1:400
  • IF: 1:10-1:100
  • Immunogen: sestrin 2
  • Uniprot ID: P58004
  • Gene ID: 83667
  • Research Area: Cardiovascular
Description: Antibody raised against Sestrin 2

anti- Sestrin 2 antibody

FNab07763 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:4000
  • IF: 1:10-1:100
  • Immunogen: sestrin 2
  • Uniprot ID: P58004
  • Gene ID: 83667
  • Research Area: Cardiovascular
Description: Antibody raised against Sestrin 2

Anti-Sestrin 2 antibody

PAab07762 100 ug
EUR 386

Anti-Sestrin 2 antibody

PAab07763 100 ug
EUR 386

SESN2 antibody

70R-10131 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SESN2 antibody

SESN2 antibody

70R-10132 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SESN2 antibody

SESN2 antibody

70R-20186 50 ul
EUR 435
Description: Rabbit polyclonal SESN2 antibody

SESN2 Antibody

37917-100ul 100ul
EUR 252

SESN2 antibody

10R-1672 100 ug
EUR 512
Description: Mouse monoclonal SESN2 antibody

SESN2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SESN2. Recognizes SESN2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

SESN2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SESN2. Recognizes SESN2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

SESN2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SESN2. Recognizes SESN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SESN2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SESN2. Recognizes SESN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21237 100 ug
EUR 403
Description: Rabbit polyclonal to SESN2

ELISA kit for Human SESN1 (Sestrin 1)

E-EL-H5530 1 plate of 96 wells
EUR 534
  • Gentaur's SESN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SESN1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SESN1 (Sestrin 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human SESN3 (Sestrin 3)

ELK5271 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 3 (SESN3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 3 (SESN3
  • Show more
Description: A sandwich ELISA kit for detection of Sestrin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human SESN1 (Sestrin 1)

ELK7773 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 1 (SESN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 1 (SESN1
  • Show more
Description: A sandwich ELISA kit for detection of Sestrin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Sestrin-3 (SESN3)

KTE60685-48T 48T
EUR 332
  • By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-3 (SESN3)

KTE60685-5platesof96wells 5 plates of 96 wells
EUR 2115
  • By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-3 (SESN3)

KTE60685-96T 96T
EUR 539
  • By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-1 (SESN1)

KTE60687-48T 48T
EUR 332
  • Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-1 (SESN1)

KTE60687-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-1 (SESN1)

KTE60687-96T 96T
EUR 539
  • Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SESN2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2127303 1.0 ug DNA
EUR 154


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human SESN2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SESN2 Recombinant Protein (Human)

RP028216 100 ug Ask for price

Mouse Sestrin 1 (SESN1) ELISA Kit

DLR-SESN1-Mu-48T 48T
EUR 527
  • Should the Mouse Sestrin 1 (SESN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 1 (SESN1) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit

DLR-SESN1-Mu-96T 96T
EUR 688
  • Should the Mouse Sestrin 1 (SESN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 1 (SESN1) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit

DLR-SESN3-Mu-48T 48T
EUR 527
  • Should the Mouse Sestrin 3 (SESN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 3 (SESN3) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit

DLR-SESN3-Mu-96T 96T
EUR 688
  • Should the Mouse Sestrin 3 (SESN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 3 (SESN3) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Sestrin 3 (SESN3) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Sestrin 1 (SESN1) ELISA Kit

abx254412-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Sestrin 3 (SESN3) ELISA Kit

abx254414-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Sestrin-3, SESN3 ELISA Kit

ELA-E12181m 96 Tests
EUR 907

Mouse Sestrin 3 (SESN3) ELISA Kit

abx570707-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse SESN1(Sestrin 1) ELISA Kit

EM1355 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P58006
  • Alias: SESN1/PA26/SEST1/p53-regulated protein PA26
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Mouse SESN3(Sestrin 3) ELISA Kit

EM1357 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9CYP7
  • Alias: SESN3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Rat Sestrin 1(SESN1)ELISA kit

QY-E10486 96T
EUR 361

Mouse Sestrin 1 (SESN1) ELISA Kit

RD-SESN1-Mu-48Tests 48 Tests
EUR 533

Mouse Sestrin 1 (SESN1) ELISA Kit

RD-SESN1-Mu-96Tests 96 Tests
EUR 740

Mouse Sestrin 3 (SESN3) ELISA Kit

RD-SESN3-Mu-48Tests 48 Tests
EUR 533

Mouse Sestrin 3 (SESN3) ELISA Kit

RD-SESN3-Mu-96Tests 96 Tests
EUR 740

Mouse Sestrin 1 ELISA Kit (SESN1)

RK03186 96 Tests
EUR 521

Mouse Sestrin 3 ELISA Kit (SESN3)

RK03187 96 Tests
EUR 521

Mouse Sestrin 1(SESN1)ELISA kit

QY-E21353 96T
EUR 361

Mouse Sestrin 1 (SESN1) ELISA Kit

RDR-SESN1-Mu-48Tests 48 Tests
EUR 557

Mouse Sestrin 1 (SESN1) ELISA Kit

RDR-SESN1-Mu-96Tests 96 Tests
EUR 774

Mouse Sestrin 3 (SESN3) ELISA Kit

RDR-SESN3-Mu-48Tests 48 Tests
EUR 557

Mouse Sestrin 3 (SESN3) ELISA Kit

RDR-SESN3-Mu-96Tests 96 Tests
EUR 774

Mouse Sestrin 3 (SESN3) ELISA Kit

SEF876Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 3 (SESN3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit

SEF876Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 3 (SESN3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit

SEF876Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 3 (SESN3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit

SEF876Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 3 (SESN3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sestrin 3 elisa. Alternative names of the recognized antigen: SEST3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Sestrin 3 (SESN3) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Sestrin 1 (SESN1) ELISA Kit

SEF877Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit

SEF877Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit

SEF877Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit

SEF877Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sestrin 1 elisa. Alternative names of the recognized antigen: SEST1
  • PA26
  • p53-regulated protein PA26
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Sestrin 1 (SESN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

SESN1 ELISA Kit| Mouse Sestrin 1 ELISA Kit

EF013886 96 Tests
EUR 689

SESN3 ELISA Kit| Mouse Sestrin 3 ELISA Kit

EF013888 96 Tests
EUR 689

Human Sestrin 3 (SESN3) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Sestrin 1 (SESN1) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

SESN2 Rabbit pAb

A14220-100ul 100 ul
EUR 308

SESN2 Rabbit pAb

A14220-200ul 200 ul
EUR 459

SESN2 Rabbit pAb

A14220-20ul 20 ul
EUR 183

SESN2 Rabbit pAb

A14220-50ul 50 ul
EUR 223

SESN2 Blocking Peptide

33R-5081 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SESN2 antibody, catalog no. 70R-10132

SESN2 Blocking Peptide

33R-5307 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SESN2 antibody, catalog no. 70R-10131

SESN2 Conjugated Antibody

C37917 100ul
EUR 397

SESN2 cloning plasmid

CSB-CL021096HU-10ug 10ug
EUR 514
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1443
  • Sequence: atgatcgtggcggactccgagtgccgcgcagagctcaaggactacctgcggttcgccccgggcggcgtcggcgactcgggccccggagaggagcagagggagagccgggctcggcgaggccctcgagggcccagcgccttcatccccgtggaggaggtccttcgggagggggctg
  • Show more
Description: A cloning plasmid for the SESN2 gene.

SESN2 Rabbit pAb

A7515-100ul 100 ul
EUR 308

SESN2 Rabbit pAb

A7515-200ul 200 ul
EUR 459

SESN2 Rabbit pAb

A7515-20ul 20 ul
EUR 183

SESN2 Rabbit pAb

A7515-50ul 50 ul
EUR 223

anti-SESN2 (3B8)

LF-MA10297 100 ug
EUR 363
Description: Mouse monoclonal to SESN2

pDONR223-SESN2 Plasmid

PVTB01139-1 2 ug
EUR 356

Anti-SESN2 antibody

STJ116436 100 µl
EUR 277
Description: This gene encodes a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.

Anti-SESN2 antibody

STJ29651 100 µl
EUR 277
Description: This gene encodes a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.

Anti-SESN2 Antibody

STJ502952 100 µg
EUR 476

Anti-SESN2 (1A12)

YF-MA19474 100 ug
EUR 363
Description: Mouse monoclonal to SESN2

ELISA kit for Mouse SESN1 (Sestrin 1)

E-EL-M1047 1 plate of 96 wells
EUR 534
  • Gentaur's SESN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse SESN1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse SESN1 (Sestrin 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse SESN3 (Sestrin 3)

E-EL-M1049 1 plate of 96 wells
EUR 534
  • Gentaur's SESN3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse SESN3. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse SESN3 (Sestrin 3) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse SESN3 (Sestrin 3)

ELK6074 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 3 (SESN3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 3 (SESN3
  • Show more
Description: A sandwich ELISA kit for detection of Sestrin 3 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse SESN1 (Sestrin 1)

ELK6075 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 1 (SESN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 1 (SESN1
  • Show more
Description: A sandwich ELISA kit for detection of Sestrin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Sestrin-3 (SESN3)

KTE70445-48T 48T
EUR 332
  • By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-3 (SESN3)

KTE70445-5platesof96wells 5 plates of 96 wells
EUR 2115
  • By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-3 (SESN3)

KTE70445-96T 96T
EUR 539
  • By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-1 (SESN1)

KTE70447-48T 48T
EUR 332
  • Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-1 (SESN1)

KTE70447-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-1 (SESN1)

KTE70447-96T 96T
EUR 539
  • Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SESN2 ORF Vector (Human) (pORF)

ORF009406 1.0 ug DNA
EUR 95

Sesn2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4588203 1.0 ug DNA
EUR 154

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

SESN2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SESN2. Recognizes SESN2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Human SESN2(Sestrin 2) ELISA Kit