Human SESN2(Sestrin 2) ELISA Kit

Human SESN2(Sestrin 2) ELISA Kit

Human Sestrin 2 (SESN2) ELISA Kit
RD-SESN2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Sestrin 2 (SESN2) ELISA Kit
RD-SESN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Sestrin 2 (SESN2) ELISA Kit
RDR-SESN2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Sestrin 2 (SESN2) ELISA Kit
RDR-SESN2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Sestrin 2 (SESN2) ELISA Kit
DLR-SESN2-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Sestrin 2 (SESN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 2 (SESN2) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit
DLR-SESN2-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Sestrin 2 (SESN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 2 (SESN2) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit
RD-SESN2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Sestrin 2 (SESN2) ELISA Kit
RD-SESN2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Sestrin 2 (SESN2) ELISA Kit
RDR-SESN2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Sestrin 2 (SESN2) ELISA Kit
RDR-SESN2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Sestrin 2 (SESN2) ELISA Kit
20-abx153067	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Sestrin 2 (SESN2) ELISA Kit
abx250844-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Sestrin 2, SESN2 ELISA Kit
ELA-E14936h	Lifescience Market	96 Tests	EUR 824

Human SESN2/ Sestrin-2 ELISA Kit
E2268Hu	Sunlong	1 Kit	EUR 571

Human SESN2(Sestrin-2) ELISA Kit
EH1556	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P58004 Alias: SESN2/Sestrin-2/Hi95/SEST2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Sestrin- 2, SESN2 ELISA KIT
ELI-04562h	Lifescience Market	96 Tests	EUR 824

Human Sestrin 2(SESN2)ELISA Kit
QY-E04602	Qayee Biotechnology	96T	EUR 361

Human Sestrin 2 ELISA Kit (SESN2)
RK02270	Abclonal	96 Tests	EUR 521

Human Sestrin 2 (SESN2) ELISA Kit
SEC840Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 2 (SESN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 2 (SESN2) ELISA Kit
SEC840Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 2 (SESN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 2 (SESN2) ELISA Kit
SEC840Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 2 (SESN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 2 (SESN2) ELISA Kit
SEC840Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 2 (SESN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 2 (SESN2) ELISA Kit
4-SEC840Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sestrin 2 elisa. Alternative names of the recognized antigen: HI95 SES2 SEST2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sestrin 2 (SESN2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Sestrin 2 (SESN2) ELISA Kit
20-abx154663	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Sestrin 2 (SESN2) ELISA Kit
abx254413-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Bovine Sestrin- 2, SESN2 ELISA KIT
ELI-04561b	Lifescience Market	96 Tests	EUR 928

Mouse Sestrin- 2, Sesn2 ELISA KIT
ELI-04563m	Lifescience Market	96 Tests	EUR 865

Mouse Sestrin 2 (SESN2) ELISA Kit
abx570705-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Cow Sestrin 2 (SESN2) ELISA Kit
abx516719-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse SESN2(Sestrin 2) ELISA Kit
EM1356	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P58043 Alias: SESN2/Sestrin-2/Hi95/SEST2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Mouse Sestrin 2 (SESN2) ELISA Kit
SEC840Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 2 (SESN2) in Tissue homogenates and other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit
SEC840Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 2 (SESN2) in Tissue homogenates and other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit
SEC840Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 2 (SESN2) in Tissue homogenates and other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit
SEC840Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 2 (SESN2) in Tissue homogenates and other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit
4-SEC840Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sestrin 2 elisa. Alternative names of the recognized antigen: HI95 SES2 SEST2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Sestrin 2 (SESN2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Sestrin 2 (SESN2) Antibody
20-abx007008	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Sestrin 2 (SESN2) Antibody
20-abx178378	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Sestrin 2 (SESN2) Antibody
20-abx178379	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Sestrin 2 (SESN2) Antibody
20-abx211656	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Sestrin 2 (SESN2) Antibody
20-abx211860	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Sestrin 2 (SESN2) Antibody
20-abx116908	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Sestrin 2 (SESN2) Antibody
20-abx129881	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Sestrin 2 (SESN2) Antibody
20-abx174529	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Sestrin 2 (SESN2) Antibody
abx237762-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Sestrin 2 (SESN2) Antibody
abx237763-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Sestrin 2 (SESN2)
4-RPC840Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P58043 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 53.7kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Sestrin 2 expressed in: E.coli

ELISA kit for Human SESN2 (Sestrin 2)
ELK4979	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 2 (SESN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 2 (SESN2 Show more
Description: A sandwich ELISA kit for detection of Sestrin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Sestrin-2 (SESN2)
KTE60686-48T	Abbkine	48T	EUR 332
Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-2 (SESN2)
KTE60686-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-2 (SESN2)
KTE60686-96T	Abbkine	96T	EUR 539
Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Sestrin 2 (SESN2) CLIA Kit
20-abx493926	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Sestrin 2 (SESN2) Protein
20-abx655052	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

ELISA kit for Mouse SESN2 (Sestrin 2)
E-EL-M1048	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's SESN2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse SESN2. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse SESN2 (Sestrin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse SESN2 (Sestrin 2)
ELK6072	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 2 (SESN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 2 (SESN2 Show more
Description: A sandwich ELISA kit for detection of Sestrin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Sestrin-2 (SESN2)
KTE70446-48T	Abbkine	48T	EUR 332
Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-2 (SESN2)
KTE70446-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-2 (SESN2)
KTE70446-96T	Abbkine	96T	EUR 539
Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SESN2 ELISA Kit| Mouse Sestrin 2 ELISA Kit
EF013887	Lifescience Market	96 Tests	EUR 689

Mouse Sestrin 2 (SESN2) CLIA Kit
abx197680-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Sestrin 2 (SESN2) CLIA Kit
20-abx493927	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Sestrin 2 (SESN2) Protein
20-abx168391	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CLIA kit for Mouse SESN2 (Sestrin 2)
E-CL-M0609	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's SESN2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse SESN2 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse SESN2 (Sestrin 2) in samples from Serum, Plasma, Cell supernatant

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse)
4-PAC840Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SESN2 (Ser41~Thr480) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2)

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), APC
4-PAC840Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SESN2 (Ser41~Thr480) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with APC.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), Biotinylated
4-PAC840Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SESN2 (Ser41~Thr480) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with Biotin.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), Cy3
4-PAC840Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SESN2 (Ser41~Thr480) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with Cy3.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), FITC
4-PAC840Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SESN2 (Ser41~Thr480) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with FITC.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), HRP
4-PAC840Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SESN2 (Ser41~Thr480) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with HRP.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), PE
4-PAC840Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SESN2 (Ser41~Thr480) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with PE.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC840Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SESN2 (Ser41~Thr480) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with APC-Cy7.

ELISA kit for Human Sestrin-2
EK3326	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sestrin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human SESN2 ELISA Kit
ELA-E1401h	Lifescience Market	96 Tests	EUR 824

SESN2 ELISA KIT|Human
EF007332	Lifescience Market	96 Tests	EUR 689

SESN2 ELISA Kit (Human) (OKAN05560)
OKAN05560	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

SESN2 ELISA Kit (Human) (OKCD08268)
OKCD08268	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL

SESN2 ELISA Kit (Human) (OKEH00986)
OKEH00986	Aviva Systems Biology	96 Wells	EUR 740
Description: Description of target: This gene encodes a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

Recombinant human Sestrin-2
P1238	FN Test	100ug	Ask for price
Uniprot ID: P58004 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Sestrin-2

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Sestrin 1 ELISA Kit
ELA-E12182h	Lifescience Market	96 Tests	EUR 824

Sestrin 2 Antibody
DF12003	Affbiotech	200ul	EUR 304
Description: Sestrin 2 antibody detects endogenous levels of Sestrin 2.

SESN2 ELISA Kit (Mouse) (OKCD02885)
OKCD02885	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Functions as an intracellular leucine sensor that negatively regulates the TORC1 signaling pathway through the GATOR complex. In absence of leucine, binds the GATOR subcomplex GATOR2 and prevents TORC1 signaling. Binding of leucine to SESN2 disrupts its interaction with GATOR2 thereby activating the TORC1 signaling pathway. This stress-inducible metabolic regulator also plays a role in protection against oxidative and genotoxic stresses. May negatively regulate protein translation in response to endoplasmic reticulum stress, via TORC1. May positively regulate the transcription by NFE2L2 of genes involved in the response to oxidative stress by facilitating the SQSTM1-mediated autophagic degradation of KEAP1. May also mediate TP53 inhibition of TORC1 signaling upon genotoxic stress. Has an alkylhydroperoxide reductase activity born by the N-terminal domain of the protein. Was originally reported to contribute to oxidative stress resistance by reducing PRDX1. However, this could not be confirmed.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.049 ng/mL

Human Sestrin 1 (SESN1)ELISA kit
201-12-2523	SunredBio	96 tests	EUR 440
This Sestrin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit
DLR-SESN1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Sestrin 1 (SESN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sestrin 1 (SESN1) in samples from tissue homogenates or other biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit
DLR-SESN1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Sestrin 1 (SESN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sestrin 1 (SESN1) in samples from tissue homogenates or other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit
DLR-SESN3-Hu-48T	DL Develop	48T	EUR 517
Should the Human Sestrin 3 (SESN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sestrin 3 (SESN3) in samples from tissue homogenates or other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit
DLR-SESN3-Hu-96T	DL Develop	96T	EUR 673
Should the Human Sestrin 3 (SESN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sestrin 3 (SESN3) in samples from tissue homogenates or other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit
20-abx156953	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Sestrin 3 (SESN3) ELISA Kit
abx253786-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Sestrin 1 (SESN1) ELISA Kit
abx253865-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Sestrin 1 (SESN1) ELISA Kit
20-abx258996	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

ELISA kit for Human Sestrin-1
EK1762	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sestrin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Sestrin-3
EK1606	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sestrin-3 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Sestrin 3, SESN3 ELISA kit
ELA-E12181h	Lifescience Market	96 Tests	EUR 824

Human SESN1/ Sestrin-1 ELISA Kit
E2267Hu	Sunlong	1 Kit	EUR 571

Human SESN3/ Sestrin-3 ELISA Kit
E2269Hu	Sunlong	1 Kit	EUR 571

Human SESN3(Sestrin-3) ELISA Kit
EH0829	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P58005 Alias: SESN3(Sestrin-3)/SEST3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human SESN1(Sestrin-1) ELISA Kit
EH0909	FN Test	96T	EUR 567.6
Detection range: 0.625-40 ng/ml Uniprot ID: Q9Y6P5 Alias: SESN1(Sestrin-1)/PA26/SEST1/p53-regulated protein PA26/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Sestrin 3(SESN3)ELISA Kit
QY-E04601	Qayee Biotechnology	96T	EUR 394

Human Sestrin 1(SESN1)ELISA Kit
QY-E04603	Qayee Biotechnology	96T	EUR 361

Human Sestrin 1 ELISA Kit (SESN1)
RK02269	Abclonal	96 Tests	EUR 521

Human Sestrin 3 ELISA Kit (SESN3)
RK02271	Abclonal	96 Tests	EUR 521

Human Sestrin 1 (SESN1) ELISA Kit
RD-SESN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Sestrin 1 (SESN1) ELISA Kit
RD-SESN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Sestrin 3 (SESN3) ELISA Kit
RD-SESN3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Sestrin 3 (SESN3) ELISA Kit
RD-SESN3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Sestrin 1 (SESN1) ELISA Kit
RDR-SESN1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Sestrin 1 (SESN1) ELISA Kit
RDR-SESN1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Sestrin 3 (SESN3) ELISA Kit
RDR-SESN3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Sestrin 3 (SESN3) ELISA Kit
RDR-SESN3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Sestrin 3 (SESN3) ELISA Kit
SEF876Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 3 (SESN3) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit
SEF876Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 3 (SESN3) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit
SEF876Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 3 (SESN3) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit
SEF876Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 3 (SESN3) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit
4-SEF876Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sestrin 3 elisa. Alternative names of the recognized antigen: SEST3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sestrin 3 (SESN3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Sestrin 1 (SESN1) ELISA Kit
SEF877Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit
SEF877Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit
SEF877Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit
SEF877Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit
4-SEF877Hu	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sestrin 1 elisa. Alternative names of the recognized antigen: SEST1 PA26 p53-regulated protein PA26
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sestrin 1 (SESN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Sestrin 2 Blocking Peptide
DF12003-BP	Affbiotech	1mg	EUR 195

anti- Sestrin 2 antibody
FNab07762	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:2000 IHC: 1:100-1:400 IF: 1:10-1:100 Immunogen: sestrin 2 Uniprot ID: P58004 Gene ID: 83667 Research Area: Cardiovascular
Description: Antibody raised against Sestrin 2

anti- Sestrin 2 antibody
FNab07763	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:1000-1:4000 IF: 1:10-1:100 Immunogen: sestrin 2 Uniprot ID: P58004 Gene ID: 83667 Research Area: Cardiovascular
Description: Antibody raised against Sestrin 2

Anti-Sestrin 2 antibody
PAab07762	Lifescience Market	100 ug	EUR 386

Anti-Sestrin 2 antibody
PAab07763	Lifescience Market	100 ug	EUR 386

SESN2 antibody
70R-10131	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal SESN2 antibody

SESN2 antibody
70R-10132	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal SESN2 antibody

SESN2 antibody
70R-20186	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SESN2 antibody

SESN2 Antibody
37917-100ul	SAB	100ul	EUR 252

SESN2 antibody
10R-1672	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal SESN2 antibody

SESN2 Antibody
1-CSB-PA831417	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SESN2. Recognizes SESN2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

SESN2 Antibody
1-CSB-PA778940	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SESN2. Recognizes SESN2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

SESN2 Antibody
1-CSB-PA021096GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SESN2. Recognizes SESN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SESN2 Antibody
1-CSB-PA021096NA01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SESN2. Recognizes SESN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

SESN2 siRNA
20-abx933040	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SESN2 siRNA
20-abx933041	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-SESN2
YF-PA21237	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to SESN2

ELISA kit for Human SESN1 (Sestrin 1)
E-EL-H5530	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's SESN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SESN1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SESN1 (Sestrin 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human SESN3 (Sestrin 3)
ELK5271	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 3 (SESN3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 3 (SESN3 Show more
Description: A sandwich ELISA kit for detection of Sestrin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human SESN1 (Sestrin 1)
ELK7773	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 1 (SESN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 1 (SESN1 Show more
Description: A sandwich ELISA kit for detection of Sestrin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Sestrin-3 (SESN3)
KTE60685-48T	Abbkine	48T	EUR 332
By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-3 (SESN3)
KTE60685-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-3 (SESN3)
KTE60685-96T	Abbkine	96T	EUR 539
By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-1 (SESN1)
KTE60687-48T	Abbkine	48T	EUR 332
Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-1 (SESN1)
KTE60687-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-1 (SESN1)
KTE60687-96T	Abbkine	96T	EUR 539
Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SESN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2127303	ABM	1.0 ug DNA	EUR 154

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human SESN2 shRNA Plasmid
20-abx963160	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SESN2 Recombinant Protein (Human)
RP028216	ABM	100 ug	Ask for price

Mouse Sestrin 1 (SESN1) ELISA Kit
DLR-SESN1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Sestrin 1 (SESN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 1 (SESN1) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit
DLR-SESN1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Sestrin 1 (SESN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 1 (SESN1) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit
DLR-SESN3-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Sestrin 3 (SESN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 3 (SESN3) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit
DLR-SESN3-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Sestrin 3 (SESN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 3 (SESN3) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit
20-abx154662	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Sestrin 3 (SESN3) ELISA Kit
20-abx154664	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Sestrin 1 (SESN1) ELISA Kit
abx254412-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Mouse Sestrin 3 (SESN3) ELISA Kit
abx254414-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Mouse Sestrin-3, SESN3 ELISA Kit
ELA-E12181m	Lifescience Market	96 Tests	EUR 907

Mouse Sestrin 3 (SESN3) ELISA Kit
abx570707-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Mouse SESN1(Sestrin 1) ELISA Kit
EM1355	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P58006 Alias: SESN1/PA26/SEST1/p53-regulated protein PA26
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Mouse SESN3(Sestrin 3) ELISA Kit
EM1357	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q9CYP7 Alias: SESN3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Rat Sestrin 1(SESN1)ELISA kit
QY-E10486	Qayee Biotechnology	96T	EUR 361

Mouse Sestrin 1 (SESN1) ELISA Kit
RD-SESN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Sestrin 1 (SESN1) ELISA Kit
RD-SESN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Sestrin 3 (SESN3) ELISA Kit
RD-SESN3-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Sestrin 3 (SESN3) ELISA Kit
RD-SESN3-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Sestrin 1 ELISA Kit (SESN1)
RK03186	Abclonal	96 Tests	EUR 521

Mouse Sestrin 3 ELISA Kit (SESN3)
RK03187	Abclonal	96 Tests	EUR 521

Mouse Sestrin 1(SESN1)ELISA kit
QY-E21353	Qayee Biotechnology	96T	EUR 361

Mouse Sestrin 1 (SESN1) ELISA Kit
RDR-SESN1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Sestrin 1 (SESN1) ELISA Kit
RDR-SESN1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Sestrin 3 (SESN3) ELISA Kit
RDR-SESN3-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Sestrin 3 (SESN3) ELISA Kit
RDR-SESN3-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Sestrin 3 (SESN3) ELISA Kit
SEF876Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 3 (SESN3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit
SEF876Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 3 (SESN3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit
SEF876Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 3 (SESN3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit
SEF876Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 3 (SESN3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit
4-SEF876Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sestrin 3 elisa. Alternative names of the recognized antigen: SEST3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Sestrin 3 (SESN3) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Sestrin 1 (SESN1) ELISA Kit
SEF877Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit
SEF877Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit
SEF877Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit
SEF877Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit
4-SEF877Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sestrin 1 elisa. Alternative names of the recognized antigen: SEST1 PA26 p53-regulated protein PA26
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Sestrin 1 (SESN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

SESN1 ELISA Kit| Mouse Sestrin 1 ELISA Kit
EF013886	Lifescience Market	96 Tests	EUR 689

SESN3 ELISA Kit| Mouse Sestrin 3 ELISA Kit
EF013888	Lifescience Market	96 Tests	EUR 689

Human Sestrin 3 (SESN3) CLIA Kit
20-abx495034	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Sestrin 1 (SESN1) CLIA Kit
20-abx496533	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

SESN2 Rabbit pAb
A14220-100ul	Abclonal	100 ul	EUR 308

SESN2 Rabbit pAb
A14220-200ul	Abclonal	200 ul	EUR 459

SESN2 Rabbit pAb
A14220-20ul	Abclonal	20 ul	EUR 183

SESN2 Rabbit pAb
A14220-50ul	Abclonal	50 ul	EUR 223

SESN2 Blocking Peptide
33R-5081	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SESN2 antibody, catalog no. 70R-10132

SESN2 Blocking Peptide
33R-5307	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SESN2 antibody, catalog no. 70R-10131

SESN2 Conjugated Antibody
C37917	SAB	100ul	EUR 397

SESN2 cloning plasmid
CSB-CL021096HU-10ug	Cusabio	10ug	EUR 514
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1443 Sequence: atgatcgtggcggactccgagtgccgcgcagagctcaaggactacctgcggttcgccccgggcggcgtcggcgactcgggccccggagaggagcagagggagagccgggctcggcgaggccctcgagggcccagcgccttcatccccgtggaggaggtccttcgggagggggctg Show more
Description: A cloning plasmid for the SESN2 gene.

SESN2 Rabbit pAb
A7515-100ul	Abclonal	100 ul	EUR 308

SESN2 Rabbit pAb
A7515-200ul	Abclonal	200 ul	EUR 459

SESN2 Rabbit pAb
A7515-20ul	Abclonal	20 ul	EUR 183

SESN2 Rabbit pAb
A7515-50ul	Abclonal	50 ul	EUR 223

anti-SESN2 (3B8)
LF-MA10297	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SESN2

pDONR223-SESN2 Plasmid
PVTB01139-1	Lifescience Market	2 ug	EUR 356

Anti-SESN2 antibody
STJ116436	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.

Anti-SESN2 antibody
STJ29651	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.

Anti-SESN2 Antibody
STJ502952	St John's Laboratory	100 µg	EUR 476

Anti-SESN2 (1A12)
YF-MA19474	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SESN2

ELISA kit for Mouse SESN1 (Sestrin 1)
E-EL-M1047	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's SESN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse SESN1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse SESN1 (Sestrin 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse SESN3 (Sestrin 3)
E-EL-M1049	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's SESN3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse SESN3. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse SESN3 (Sestrin 3) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse SESN3 (Sestrin 3)
ELK6074	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 3 (SESN3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 3 (SESN3 Show more
Description: A sandwich ELISA kit for detection of Sestrin 3 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse SESN1 (Sestrin 1)
ELK6075	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 1 (SESN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 1 (SESN1 Show more
Description: A sandwich ELISA kit for detection of Sestrin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Sestrin-3 (SESN3)
KTE70445-48T	Abbkine	48T	EUR 332
By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-3 (SESN3)
KTE70445-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-3 (SESN3)
KTE70445-96T	Abbkine	96T	EUR 539
By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-1 (SESN1)
KTE70447-48T	Abbkine	48T	EUR 332
Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-1 (SESN1)
KTE70447-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-1 (SESN1)
KTE70447-96T	Abbkine	96T	EUR 539
Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SESN2 ORF Vector (Human) (pORF)
ORF009406	ABM	1.0 ug DNA	EUR 95

Sesn2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4588203	ABM	1.0 ug DNA	EUR 154

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

SESN2 Antibody, HRP conjugated
1-CSB-PA021096NB01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SESN2. Recognizes SESN2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Human SESN2(Sestrin 2) ELISA Kit