Skip to content
Theragen Bio

Research Data

  • Home
  • Western Blot Reagents
  • Body’s bugs to be sequenced
  • Our products
  • Home
  • Western Blot Reagents
  • Body’s bugs to be sequenced
  • Our products

Human SESN2(Sestrin 2) ELISA Kit

  • Home
  • Human SESN2(Sestrin 2) ELISA Kit

Human SESN2(Sestrin 2) ELISA Kit

Human Sestrin 2 (SESN2) ELISA Kit

RD-SESN2-Hu-48Tests Reddot Biotech 48 Tests
EUR 521

Human Sestrin 2 (SESN2) ELISA Kit

RD-SESN2-Hu-96Tests Reddot Biotech 96 Tests
EUR 723

Human Sestrin 2 (SESN2) ELISA Kit

RDR-SESN2-Hu-48Tests Reddot Biotech 48 Tests
EUR 544

Human Sestrin 2 (SESN2) ELISA Kit

RDR-SESN2-Hu-96Tests Reddot Biotech 96 Tests
EUR 756

Mouse Sestrin 2 (SESN2) ELISA Kit

DLR-SESN2-Mu-48T DL Develop 48T
EUR 527
  • Should the Mouse Sestrin 2 (SESN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 2 (SESN2) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit

DLR-SESN2-Mu-96T DL Develop 96T
EUR 688
  • Should the Mouse Sestrin 2 (SESN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 2 (SESN2) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit

RD-SESN2-Mu-48Tests Reddot Biotech 48 Tests
EUR 533

Mouse Sestrin 2 (SESN2) ELISA Kit

RD-SESN2-Mu-96Tests Reddot Biotech 96 Tests
EUR 740

Mouse Sestrin 2 (SESN2) ELISA Kit

RDR-SESN2-Mu-48Tests Reddot Biotech 48 Tests
EUR 557

Mouse Sestrin 2 (SESN2) ELISA Kit

RDR-SESN2-Mu-96Tests Reddot Biotech 96 Tests
EUR 774

Human Sestrin 2 (SESN2) ELISA Kit

20-abx153067 Abbexa
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Sestrin 2 (SESN2) ELISA Kit

abx250844-96tests Abbexa 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Sestrin 2, SESN2 ELISA Kit

ELA-E14936h Lifescience Market 96 Tests
EUR 824

Human SESN2/ Sestrin-2 ELISA Kit

E2268Hu Sunlong 1 Kit
EUR 571

Human SESN2(Sestrin-2) ELISA Kit

EH1556 FN Test 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P58004
  • Alias: SESN2/Sestrin-2/Hi95/SEST2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Sestrin- 2, SESN2 ELISA KIT

ELI-04562h Lifescience Market 96 Tests
EUR 824

Human Sestrin 2(SESN2)ELISA Kit

QY-E04602 Qayee Biotechnology 96T
EUR 361

Human Sestrin 2 ELISA Kit (SESN2)

RK02270 Abclonal 96 Tests
EUR 521

Human Sestrin 2 (SESN2) ELISA Kit

SEC840Hu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 2 (SESN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 2 (SESN2) ELISA Kit

SEC840Hu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 2 (SESN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 2 (SESN2) ELISA Kit

SEC840Hu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 2 (SESN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 2 (SESN2) ELISA Kit

SEC840Hu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 2 (SESN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 2 (SESN2) ELISA Kit

4-SEC840Hu Cloud-Clone
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sestrin 2 elisa. Alternative names of the recognized antigen: HI95
  • SES2
  • SEST2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sestrin 2 (SESN2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Sestrin 2 (SESN2) ELISA Kit

20-abx154663 Abbexa
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Sestrin 2 (SESN2) ELISA Kit

abx254413-96tests Abbexa 96 tests
EUR 707
  • Shipped within 5-12 working days.

Bovine Sestrin- 2, SESN2 ELISA KIT

ELI-04561b Lifescience Market 96 Tests
EUR 928

Mouse Sestrin- 2, Sesn2 ELISA KIT

ELI-04563m Lifescience Market 96 Tests
EUR 865

Mouse Sestrin 2 (SESN2) ELISA Kit

abx570705-96tests Abbexa 96 tests
EUR 707
  • Shipped within 5-12 working days.

Cow Sestrin 2 (SESN2) ELISA Kit

abx516719-96tests Abbexa 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse SESN2(Sestrin 2) ELISA Kit

EM1356 FN Test 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P58043
  • Alias: SESN2/Sestrin-2/Hi95/SEST2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Mouse Sestrin 2 (SESN2) ELISA Kit

SEC840Mu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 2 (SESN2) in Tissue homogenates and other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit

SEC840Mu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 2 (SESN2) in Tissue homogenates and other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit

SEC840Mu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 2 (SESN2) in Tissue homogenates and other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit

SEC840Mu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 2 (SESN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 2 (SESN2) in Tissue homogenates and other biological fluids.

Mouse Sestrin 2 (SESN2) ELISA Kit

4-SEC840Mu Cloud-Clone
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sestrin 2 elisa. Alternative names of the recognized antigen: HI95
  • SES2
  • SEST2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Sestrin 2 (SESN2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Sestrin 2 (SESN2) Antibody

20-abx007008 Abbexa
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sestrin 2 (SESN2) Antibody

20-abx178378 Abbexa
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sestrin 2 (SESN2) Antibody

20-abx178379 Abbexa
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sestrin 2 (SESN2) Antibody

20-abx211656 Abbexa
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sestrin 2 (SESN2) Antibody

20-abx211860 Abbexa
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sestrin 2 (SESN2) Antibody

20-abx116908 Abbexa
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sestrin 2 (SESN2) Antibody

20-abx129881 Abbexa
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sestrin 2 (SESN2) Antibody

20-abx174529 Abbexa
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sestrin 2 (SESN2) Antibody

abx237762-100ug Abbexa 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sestrin 2 (SESN2) Antibody

abx237763-100ug Abbexa 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Sestrin 2 (SESN2)

4-RPC840Mu01 Cloud-Clone
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P58043
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Sestrin 2 expressed in: E.coli

ELISA kit for Human SESN2 (Sestrin 2)

ELK4979 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 2 (SESN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 2 (SESN2
  • Show more
Description: A sandwich ELISA kit for detection of Sestrin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Sestrin-2 (SESN2)

KTE60686-48T Abbkine 48T
EUR 332
  • Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-2 (SESN2)

KTE60686-5platesof96wells Abbkine 5 plates of 96 wells
EUR 2115
  • Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-2 (SESN2)

KTE60686-96T Abbkine 96T
EUR 539
  • Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Sestrin 2 (SESN2) CLIA Kit

20-abx493926 Abbexa
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Sestrin 2 (SESN2) Protein

20-abx655052 Abbexa
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Mouse SESN2 (Sestrin 2)

E-EL-M1048 Elabscience Biotech 1 plate of 96 wells
EUR 534
  • Gentaur's SESN2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse SESN2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse SESN2 (Sestrin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse SESN2 (Sestrin 2)

ELK6072 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 2 (SESN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 2 (SESN2
  • Show more
Description: A sandwich ELISA kit for detection of Sestrin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Sestrin-2 (SESN2)

KTE70446-48T Abbkine 48T
EUR 332
  • Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-2 (SESN2)

KTE70446-5platesof96wells Abbkine 5 plates of 96 wells
EUR 2115
  • Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-2 (SESN2)

KTE70446-96T Abbkine 96T
EUR 539
  • Sestrin-2 is a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.The full-length SES
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-2 (SESN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SESN2 ELISA Kit| Mouse Sestrin 2 ELISA Kit

EF013887 Lifescience Market 96 Tests
EUR 689

Mouse Sestrin 2 (SESN2) CLIA Kit

abx197680-96tests Abbexa 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Sestrin 2 (SESN2) CLIA Kit

20-abx493927 Abbexa
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Sestrin 2 (SESN2) Protein

20-abx168391 Abbexa
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CLIA kit for Mouse SESN2 (Sestrin 2)

E-CL-M0609 Elabscience Biotech 1 plate of 96 wells
EUR 584
  • Gentaur's SESN2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse SESN2 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse SESN2 (Sestrin 2) in samples from Serum, Plasma, Cell supernatant

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse)

4-PAC840Mu01 Cloud-Clone
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2)

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), APC

4-PAC840Mu01-APC Cloud-Clone
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with APC.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), Biotinylated

4-PAC840Mu01-Biotin Cloud-Clone
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with Biotin.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), Cy3

4-PAC840Mu01-Cy3 Cloud-Clone
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with Cy3.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), FITC

4-PAC840Mu01-FITC Cloud-Clone
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with FITC.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), HRP

4-PAC840Mu01-HRP Cloud-Clone
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with HRP.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), PE

4-PAC840Mu01-PE Cloud-Clone
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with PE.

Sestrin 2 (SESN2) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC840Mu01-APC-Cy7 Cloud-Clone
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SESN2 (Ser41~Thr480)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Sestrin 2 (SESN2). This antibody is labeled with APC-Cy7.

ELISA kit for Human Sestrin-2

EK3326 SAB 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sestrin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human SESN2 ELISA Kit

ELA-E1401h Lifescience Market 96 Tests
EUR 824

SESN2 ELISA KIT|Human

EF007332 Lifescience Market 96 Tests
EUR 689

SESN2 ELISA Kit (Human) (OKAN05560)

OKAN05560 Aviva Systems Biology 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

SESN2 ELISA Kit (Human) (OKCD08268)

OKCD08268 Aviva Systems Biology 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL

SESN2 ELISA Kit (Human) (OKEH00986)

OKEH00986 Aviva Systems Biology 96 Wells
EUR 740
Description: Description of target: This gene encodes a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

Recombinant human Sestrin-2

P1238 FN Test 100ug Ask for price
  • Uniprot ID: P58004
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Sestrin-2

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 Alpha Diagnostics 1
EUR 202

Human Sestrin 1 ELISA Kit

ELA-E12182h Lifescience Market 96 Tests
EUR 824

Sestrin 2 Antibody

DF12003 Affbiotech 200ul
EUR 304
Description: Sestrin 2 antibody detects endogenous levels of Sestrin 2.

SESN2 ELISA Kit (Mouse) (OKCD02885)

OKCD02885 Aviva Systems Biology 96 Wells
EUR 857
Description: Description of target: Functions as an intracellular leucine sensor that negatively regulates the TORC1 signaling pathway through the GATOR complex. In absence of leucine, binds the GATOR subcomplex GATOR2 and prevents TORC1 signaling. Binding of leucine to SESN2 disrupts its interaction with GATOR2 thereby activating the TORC1 signaling pathway. This stress-inducible metabolic regulator also plays a role in protection against oxidative and genotoxic stresses. May negatively regulate protein translation in response to endoplasmic reticulum stress, via TORC1. May positively regulate the transcription by NFE2L2 of genes involved in the response to oxidative stress by facilitating the SQSTM1-mediated autophagic degradation of KEAP1. May also mediate TP53 inhibition of TORC1 signaling upon genotoxic stress. Has an alkylhydroperoxide reductase activity born by the N-terminal domain of the protein. Was originally reported to contribute to oxidative stress resistance by reducing PRDX1. However, this could not be confirmed.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.049 ng/mL

Human Sestrin 1 (SESN1)ELISA kit

201-12-2523 SunredBio 96 tests
EUR 440
  • This Sestrin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit

DLR-SESN1-Hu-48T DL Develop 48T
EUR 517
  • Should the Human Sestrin 1 (SESN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sestrin 1 (SESN1) in samples from tissue homogenates or other biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit

DLR-SESN1-Hu-96T DL Develop 96T
EUR 673
  • Should the Human Sestrin 1 (SESN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sestrin 1 (SESN1) in samples from tissue homogenates or other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit

DLR-SESN3-Hu-48T DL Develop 48T
EUR 517
  • Should the Human Sestrin 3 (SESN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sestrin 3 (SESN3) in samples from tissue homogenates or other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit

DLR-SESN3-Hu-96T DL Develop 96T
EUR 673
  • Should the Human Sestrin 3 (SESN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sestrin 3 (SESN3) in samples from tissue homogenates or other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit

20-abx156953 Abbexa
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Sestrin 3 (SESN3) ELISA Kit

abx253786-96tests Abbexa 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Sestrin 1 (SESN1) ELISA Kit

abx253865-96tests Abbexa 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Sestrin 1 (SESN1) ELISA Kit

20-abx258996 Abbexa
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

ELISA kit for Human Sestrin-1

EK1762 SAB 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sestrin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Sestrin-3

EK1606 SAB 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sestrin-3 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Sestrin 3, SESN3 ELISA kit

ELA-E12181h Lifescience Market 96 Tests
EUR 824

Human SESN1/ Sestrin-1 ELISA Kit

E2267Hu Sunlong 1 Kit
EUR 571

Human SESN3/ Sestrin-3 ELISA Kit

E2269Hu Sunlong 1 Kit
EUR 571

Human SESN3(Sestrin-3) ELISA Kit

EH0829 FN Test 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P58005
  • Alias: SESN3(Sestrin-3)/SEST3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human SESN1(Sestrin-1) ELISA Kit

EH0909 FN Test 96T
EUR 567.6
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q9Y6P5
  • Alias: SESN1(Sestrin-1)/PA26/SEST1/p53-regulated protein PA26/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Sestrin 3(SESN3)ELISA Kit  

QY-E04601 Qayee Biotechnology 96T
EUR 394

Human Sestrin 1(SESN1)ELISA Kit

QY-E04603 Qayee Biotechnology 96T
EUR 361

Human Sestrin 1 ELISA Kit (SESN1)

RK02269 Abclonal 96 Tests
EUR 521

Human Sestrin 3 ELISA Kit (SESN3)

RK02271 Abclonal 96 Tests
EUR 521

Human Sestrin 1 (SESN1) ELISA Kit

RD-SESN1-Hu-48Tests Reddot Biotech 48 Tests
EUR 521

Human Sestrin 1 (SESN1) ELISA Kit

RD-SESN1-Hu-96Tests Reddot Biotech 96 Tests
EUR 723

Human Sestrin 3 (SESN3) ELISA Kit

RD-SESN3-Hu-48Tests Reddot Biotech 48 Tests
EUR 521

Human Sestrin 3 (SESN3) ELISA Kit

RD-SESN3-Hu-96Tests Reddot Biotech 96 Tests
EUR 723

Human Sestrin 1 (SESN1) ELISA Kit

RDR-SESN1-Hu-48Tests Reddot Biotech 48 Tests
EUR 544

Human Sestrin 1 (SESN1) ELISA Kit

RDR-SESN1-Hu-96Tests Reddot Biotech 96 Tests
EUR 756

Human Sestrin 3 (SESN3) ELISA Kit

RDR-SESN3-Hu-48Tests Reddot Biotech 48 Tests
EUR 544

Human Sestrin 3 (SESN3) ELISA Kit

RDR-SESN3-Hu-96Tests Reddot Biotech 96 Tests
EUR 756

Human Sestrin 3 (SESN3) ELISA Kit

SEF876Hu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 3 (SESN3) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit

SEF876Hu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 3 (SESN3) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit

SEF876Hu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 3 (SESN3) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit

SEF876Hu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 3 (SESN3) in Tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 3 (SESN3) ELISA Kit

4-SEF876Hu Cloud-Clone
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sestrin 3 elisa. Alternative names of the recognized antigen: SEST3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sestrin 3 (SESN3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Sestrin 1 (SESN1) ELISA Kit

SEF877Hu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit

SEF877Hu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit

SEF877Hu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit

SEF877Hu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Human Sestrin 1 (SESN1) ELISA Kit

4-SEF877Hu Cloud-Clone
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sestrin 1 elisa. Alternative names of the recognized antigen: SEST1
  • PA26
  • p53-regulated protein PA26
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sestrin 1 (SESN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Sestrin 2 Blocking Peptide

DF12003-BP Affbiotech 1mg
EUR 195

anti- Sestrin 2 antibody

FNab07762 FN Test 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:100-1:400
  • IF: 1:10-1:100
  • Immunogen: sestrin 2
  • Uniprot ID: P58004
  • Gene ID: 83667
  • Research Area: Cardiovascular
Description: Antibody raised against Sestrin 2

anti- Sestrin 2 antibody

FNab07763 FN Test 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:4000
  • IF: 1:10-1:100
  • Immunogen: sestrin 2
  • Uniprot ID: P58004
  • Gene ID: 83667
  • Research Area: Cardiovascular
Description: Antibody raised against Sestrin 2

Anti-Sestrin 2 antibody

PAab07762 Lifescience Market 100 ug
EUR 386

Anti-Sestrin 2 antibody

PAab07763 Lifescience Market 100 ug
EUR 386

SESN2 antibody

70R-10131 Fitzgerald 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SESN2 antibody

SESN2 antibody

70R-10132 Fitzgerald 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SESN2 antibody

SESN2 antibody

70R-20186 Fitzgerald 50 ul
EUR 435
Description: Rabbit polyclonal SESN2 antibody

SESN2 Antibody

37917-100ul SAB 100ul
EUR 252

SESN2 antibody

10R-1672 Fitzgerald 100 ug
EUR 512
Description: Mouse monoclonal SESN2 antibody

SESN2 Antibody

1-CSB-PA831417 Cusabio
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SESN2. Recognizes SESN2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

SESN2 Antibody

1-CSB-PA778940 Cusabio
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SESN2. Recognizes SESN2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

SESN2 Antibody

1-CSB-PA021096GA01HU Cusabio
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SESN2. Recognizes SESN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SESN2 Antibody

1-CSB-PA021096NA01HU Cusabio
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SESN2. Recognizes SESN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

SESN2 siRNA

20-abx933040 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SESN2 siRNA

20-abx933041 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SESN2

YF-PA21237 Abfrontier 100 ug
EUR 403
Description: Rabbit polyclonal to SESN2

ELISA kit for Human SESN1 (Sestrin 1)

E-EL-H5530 Elabscience Biotech 1 plate of 96 wells
EUR 534
  • Gentaur's SESN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SESN1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SESN1 (Sestrin 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human SESN3 (Sestrin 3)

ELK5271 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 3 (SESN3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 3 (SESN3
  • Show more
Description: A sandwich ELISA kit for detection of Sestrin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human SESN1 (Sestrin 1)

ELK7773 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 1 (SESN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 1 (SESN1
  • Show more
Description: A sandwich ELISA kit for detection of Sestrin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Sestrin-3 (SESN3)

KTE60685-48T Abbkine 48T
EUR 332
  • By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-3 (SESN3)

KTE60685-5platesof96wells Abbkine 5 plates of 96 wells
EUR 2115
  • By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-3 (SESN3)

KTE60685-96T Abbkine 96T
EUR 539
  • By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-1 (SESN1)

KTE60687-48T Abbkine 48T
EUR 332
  • Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-1 (SESN1)

KTE60687-5platesof96wells Abbkine 5 plates of 96 wells
EUR 2115
  • Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sestrin-1 (SESN1)

KTE60687-96T Abbkine 96T
EUR 539
  • Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SESN2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2127303 ABM 1.0 ug DNA
EUR 154

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 CORNING 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human SESN2 shRNA Plasmid

20-abx963160 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SESN2 Recombinant Protein (Human)

RP028216 ABM 100 ug Ask for price

Mouse Sestrin 1 (SESN1) ELISA Kit

DLR-SESN1-Mu-48T DL Develop 48T
EUR 527
  • Should the Mouse Sestrin 1 (SESN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 1 (SESN1) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit

DLR-SESN1-Mu-96T DL Develop 96T
EUR 688
  • Should the Mouse Sestrin 1 (SESN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 1 (SESN1) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit

DLR-SESN3-Mu-48T DL Develop 48T
EUR 527
  • Should the Mouse Sestrin 3 (SESN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 3 (SESN3) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit

DLR-SESN3-Mu-96T DL Develop 96T
EUR 688
  • Should the Mouse Sestrin 3 (SESN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Sestrin 3 (SESN3) in samples from tissue homogenates or other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit

20-abx154662 Abbexa
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Sestrin 3 (SESN3) ELISA Kit

20-abx154664 Abbexa
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Sestrin 1 (SESN1) ELISA Kit

abx254412-96tests Abbexa 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Sestrin 3 (SESN3) ELISA Kit

abx254414-96tests Abbexa 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Sestrin-3, SESN3 ELISA Kit

ELA-E12181m Lifescience Market 96 Tests
EUR 907

Mouse Sestrin 3 (SESN3) ELISA Kit

abx570707-96tests Abbexa 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse SESN1(Sestrin 1) ELISA Kit

EM1355 FN Test 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P58006
  • Alias: SESN1/PA26/SEST1/p53-regulated protein PA26
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Mouse SESN3(Sestrin 3) ELISA Kit

EM1357 FN Test 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9CYP7
  • Alias: SESN3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Rat Sestrin 1(SESN1)ELISA kit

QY-E10486 Qayee Biotechnology 96T
EUR 361

Mouse Sestrin 1 (SESN1) ELISA Kit

RD-SESN1-Mu-48Tests Reddot Biotech 48 Tests
EUR 533

Mouse Sestrin 1 (SESN1) ELISA Kit

RD-SESN1-Mu-96Tests Reddot Biotech 96 Tests
EUR 740

Mouse Sestrin 3 (SESN3) ELISA Kit

RD-SESN3-Mu-48Tests Reddot Biotech 48 Tests
EUR 533

Mouse Sestrin 3 (SESN3) ELISA Kit

RD-SESN3-Mu-96Tests Reddot Biotech 96 Tests
EUR 740

Mouse Sestrin 1 ELISA Kit (SESN1)

RK03186 Abclonal 96 Tests
EUR 521

Mouse Sestrin 3 ELISA Kit (SESN3)

RK03187 Abclonal 96 Tests
EUR 521

Mouse Sestrin 1(SESN1)ELISA kit

QY-E21353 Qayee Biotechnology 96T
EUR 361

Mouse Sestrin 1 (SESN1) ELISA Kit

RDR-SESN1-Mu-48Tests Reddot Biotech 48 Tests
EUR 557

Mouse Sestrin 1 (SESN1) ELISA Kit

RDR-SESN1-Mu-96Tests Reddot Biotech 96 Tests
EUR 774

Mouse Sestrin 3 (SESN3) ELISA Kit

RDR-SESN3-Mu-48Tests Reddot Biotech 48 Tests
EUR 557

Mouse Sestrin 3 (SESN3) ELISA Kit

RDR-SESN3-Mu-96Tests Reddot Biotech 96 Tests
EUR 774

Mouse Sestrin 3 (SESN3) ELISA Kit

SEF876Mu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 3 (SESN3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit

SEF876Mu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 3 (SESN3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit

SEF876Mu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 3 (SESN3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit

SEF876Mu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 3 (SESN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 3 (SESN3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 3 (SESN3) ELISA Kit

4-SEF876Mu Cloud-Clone
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sestrin 3 elisa. Alternative names of the recognized antigen: SEST3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Sestrin 3 (SESN3) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Sestrin 1 (SESN1) ELISA Kit

SEF877Mu-10x96wellstestplate Cloud-Clone 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit

SEF877Mu-1x48wellstestplate Cloud-Clone 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit

SEF877Mu-1x96wellstestplate Cloud-Clone 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit

SEF877Mu-5x96wellstestplate Cloud-Clone 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Sestrin 1 (SESN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Sestrin 1 (SESN1) in tissue homogenates, cell lysates and other biological fluids.

Mouse Sestrin 1 (SESN1) ELISA Kit

4-SEF877Mu Cloud-Clone
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sestrin 1 elisa. Alternative names of the recognized antigen: SEST1
  • PA26
  • p53-regulated protein PA26
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Sestrin 1 (SESN1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

SESN1 ELISA Kit| Mouse Sestrin 1 ELISA Kit

EF013886 Lifescience Market 96 Tests
EUR 689

SESN3 ELISA Kit| Mouse Sestrin 3 ELISA Kit

EF013888 Lifescience Market 96 Tests
EUR 689

Human Sestrin 3 (SESN3) CLIA Kit

20-abx495034 Abbexa
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Sestrin 1 (SESN1) CLIA Kit

20-abx496533 Abbexa
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

SESN2 Rabbit pAb

A14220-100ul Abclonal 100 ul
EUR 308

SESN2 Rabbit pAb

A14220-200ul Abclonal 200 ul
EUR 459

SESN2 Rabbit pAb

A14220-20ul Abclonal 20 ul
EUR 183

SESN2 Rabbit pAb

A14220-50ul Abclonal 50 ul
EUR 223

SESN2 Blocking Peptide

33R-5081 Fitzgerald 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SESN2 antibody, catalog no. 70R-10132

SESN2 Blocking Peptide

33R-5307 Fitzgerald 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SESN2 antibody, catalog no. 70R-10131

SESN2 Conjugated Antibody

C37917 SAB 100ul
EUR 397

SESN2 cloning plasmid

CSB-CL021096HU-10ug Cusabio 10ug
EUR 514
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1443
  • Sequence: atgatcgtggcggactccgagtgccgcgcagagctcaaggactacctgcggttcgccccgggcggcgtcggcgactcgggccccggagaggagcagagggagagccgggctcggcgaggccctcgagggcccagcgccttcatccccgtggaggaggtccttcgggagggggctg
  • Show more
Description: A cloning plasmid for the SESN2 gene.

SESN2 Rabbit pAb

A7515-100ul Abclonal 100 ul
EUR 308

SESN2 Rabbit pAb

A7515-200ul Abclonal 200 ul
EUR 459

SESN2 Rabbit pAb

A7515-20ul Abclonal 20 ul
EUR 183

SESN2 Rabbit pAb

A7515-50ul Abclonal 50 ul
EUR 223

anti-SESN2 (3B8)

LF-MA10297 Abfrontier 100 ug
EUR 363
Description: Mouse monoclonal to SESN2

pDONR223-SESN2 Plasmid

PVTB01139-1 Lifescience Market 2 ug
EUR 356

Anti-SESN2 antibody

STJ116436 St John's Laboratory 100 µl
EUR 277
Description: This gene encodes a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.

Anti-SESN2 antibody

STJ29651 St John's Laboratory 100 µl
EUR 277
Description: This gene encodes a member of the sestrin family of PA26-related proteins. The encoded protein may function in the regulation of cell growth and survival. This protein may be involved in cellular response to different stress conditions.

Anti-SESN2 Antibody

STJ502952 St John's Laboratory 100 µg
EUR 476

Anti-SESN2 (1A12)

YF-MA19474 Abfrontier 100 ug
EUR 363
Description: Mouse monoclonal to SESN2

ELISA kit for Mouse SESN1 (Sestrin 1)

E-EL-M1047 Elabscience Biotech 1 plate of 96 wells
EUR 534
  • Gentaur's SESN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse SESN1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse SESN1 (Sestrin 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse SESN3 (Sestrin 3)

E-EL-M1049 Elabscience Biotech 1 plate of 96 wells
EUR 534
  • Gentaur's SESN3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse SESN3. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse SESN3 (Sestrin 3) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse SESN3 (Sestrin 3)

ELK6074 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 3 (SESN3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 3 (SESN3
  • Show more
Description: A sandwich ELISA kit for detection of Sestrin 3 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse SESN1 (Sestrin 1)

ELK6075 ELK Biotech 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sestrin 1 (SESN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sestrin 1 (SESN1
  • Show more
Description: A sandwich ELISA kit for detection of Sestrin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Sestrin-3 (SESN3)

KTE70445-48T Abbkine 48T
EUR 332
  • By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-3 (SESN3)

KTE70445-5platesof96wells Abbkine 5 plates of 96 wells
EUR 2115
  • By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-3 (SESN3)

KTE70445-96T Abbkine 96T
EUR 539
  • By database mining, Peeters et al. (2003) identified a gene family related to p53-activated gene-26 (PA26), which they termed the sestrin family. Sequence alignment of human and mouse sestrin protein family members showed that the gene family is high
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-3 (SESN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-1 (SESN1)

KTE70447-48T Abbkine 48T
EUR 332
  • Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-1 (SESN1)

KTE70447-5platesof96wells Abbkine 5 plates of 96 wells
EUR 2115
  • Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sestrin-1 (SESN1)

KTE70447-96T Abbkine 96T
EUR 539
  • Only the smaller transcript was transiently induced by p53 or by genotoxic agents in a p53-dependent manner in a colon carcinoma cell line. The deduced proteins, which are 99% identical to the mouse proteins, contain 551, 491, and 426 amino acids, re
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sestrin-1 (SESN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SESN2 ORF Vector (Human) (pORF)

ORF009406 ABM 1.0 ug DNA
EUR 95

Sesn2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4588203 ABM 1.0 ug DNA
EUR 154

Frit Kit

FRIT-KIT Next Advance 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT Next Advance 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit TOKU-E Kit
EUR 266

SESN2 Antibody, HRP conjugated

1-CSB-PA021096NB01HU Cusabio
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SESN2. Recognizes SESN2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Human SESN2(Sestrin 2) ELISA Kit

Recent Posts
  • ANTIBODY FINDER, PROTEINS AND ELISA KITS
  • QPCR Troubleshooting Guide
  • An up-to-date review on bio-resource therapeutics effective against bacterial species frequently associated with chronic sinusitis and tonsillitis
  • Bio-Fabrication: Convergence of 3D Bioprinting and Nano-Biomaterials in Tissue Engineering and Regenerative Medicine
  • Recognition of Patient Groups with Sleep Related Disorders using Bio-signal Processing and Deep Learning
Categories
  • An up-to-date review on bio-resource therapeutics effective against bacterial species frequently associated with chronic sinusitis and tonsillitis.
  • Bio-chemo-electro-mechanical modelling of the rapid movement of Mimosa pudica
  • Bio-Fabrication: Convergence of 3D Bioprinting and Nano-Biomaterials in Tissue Engineering and Regenerative Medicine
  • Exploring the additive bio-agent impacts upon ectoine production by Halomonas salina DSM5928T using corn steep liquor and soybean hydrolysate as nutrient supplement
  • Recognition of Patient Groups with Sleep Related Disorders using Bio-signal Processing and Deep Learning
  • Uncategorized

© 2019 All Right Reserved | Arowana WordPress Theme